Stem-loop sequence mml-mir-548e

AccessionMI0007823
DescriptionMacaca mulatta miR-548e stem-loop
Gene family MIPF0000317; mir-548
Stem-loop
ccuagaa      uag                    ga     a     ac 
       uguuac   guuggugcaaaaguaauugc  guuuu ccauu  u
       ||||||   ||||||||||||||||||||  ||||| |||||   
       auaaug   caaccacguuuucauugacg  caaaa gguaa  u
----uuc      ---                    gc     c     cu 
Get sequence
Deep sequencing
10 reads, 0.283 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr8: 109333178-109333274 [-]
intergenic
Database links

Mature sequence mml-miR-548e

Accession MIMAT0006415
Sequence

61 - 

caaaaccggcaguuacuuuugc

 - 82

Get sequence
Evidence by similarity; MI0003612
Predicted targets

References

1