Stem-loop sequence mml-mir-548e

AccessionMI0007823 (change log)
DescriptionMacaca mulatta miR-548e stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention mml-mir-548e
(2 sentences)

Stem-loop
   ccuagaa      uag                    ga     a     ac 
5'        uguuac   guuggugcaaaaguaauugc  guuuu ccauu  u
          ||||||   ||||||||||||||||||||  ||||| |||||   
3'        auaaug   caaccacguuuucauugacg  caaaa gguaa  u
   ----uuc      ---                    gc     c     cu 
Get sequence
Deep sequencing
312 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr8: 103261039-103261135 [-]
intergenic
Database links

Mature sequence mml-miR-548e

Accession MIMAT0006415
Sequence

61 - 

caaaaccggcaguuacuuuugc

 - 82

Get sequence
Deep sequencing7 reads, 5 experiments
Evidence by similarity; MI0003612
Predicted targets

References

1