Stem-loop sequence mml-mir-548d

Accession MI0007822
Description Macaca mulatta miR-548d stem-loop
Gene family MIPF0000317; mir-548
Stem-loop
   aaacaaguug      g            u          c     uauaa 
5'           uauuag uuggugcaaaag aauugugguu uugcc     a
             |||||| |||||||||||| |||||||||| |||||      
3'           auaauc aaccacguuuuc uuaacaccaa aacgg     a
   -------gaa      a            u          a     uaaug 
Get sequence
Deep sequencing
98 reads, 2.72 reads per million, 7 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr8: 128281263-128281359 [-]
intergenic
Database links

Mature sequence mml-miR-548d-5p

Accession MIMAT0006413
Sequence

59 - 

ggcaaaaaccacaauuucuuuu

 - 80

Get sequence
Evidence by similarity; MI0003668
Predicted targets

Mature sequence mml-miR-548d-3p

Accession MIMAT0006414
Sequence

61 - 

caaaaaccacaauuucuuuugc

 - 82

Get sequence
Evidence by similarity; MI0003668
Predicted targets

References

1