Stem-loop sequence mml-mir-548d

AccessionMI0007822 (change log)
DescriptionMacaca mulatta miR-548d stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention mml-mir-548d
(2 sentences)

Stem-loop
   aaacaaguug      g            u          c     uauaa 
5'           uauuag uuggugcaaaag aauugugguu uugcc     a
             |||||| |||||||||||| |||||||||| |||||      
3'           auaauc aaccacguuuuc uuaacaccaa aacgg     a
   -------gaa      a            u          a     uaaug 
Get sequence
Deep sequencing
2669 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr8: 122550839-122550935 [-]
intergenic
Database links

Mature sequence mml-miR-548d-5p

Accession MIMAT0006413
Sequence

59 - 

ggcaaaaaccacaauuucuuuu

 - 80

Get sequence
Deep sequencing26 reads, 7 experiments
Evidence by similarity; MI0003668
Predicted targets

Mature sequence mml-miR-548d-3p

Accession MIMAT0006414
Sequence

61 - 

caaaaaccacaauuucuuuugc

 - 82

Get sequence
Deep sequencing26 reads, 7 experiments
Evidence by similarity; MI0003668
Predicted targets

References

1