Stem-loop sequence mml-mir-548c

Accession MI0007821
Description Macaca mulatta miR-548c stem-loop
Gene family MIPF0000317; mir-548
Stem-loop
   uguga        g   a    a         -g     uu        a 
5'      uguauuag uug ugca aaguaauug  gguuu  ugucauua a
        |||||||| ||| |||| |||||||||  |||||  ||||||||  
3'      auauaauc aac acgu uucauuaac  ccaaa  acagugau a
   ----a        a   c    c         gg     --        g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr4: 130842354-130842448 [-]
intergenic
Database links

Mature sequence mml-miR-548c

Accession MIMAT0006412
Sequence

59 - 

caaaaccggcaauuacuucugc

 - 80

Get sequence
Evidence by similarity; MI0003598
Predicted targets

References

1