Stem-loop sequence mml-mir-548b

Accession MI0007820
Description Macaca mulatta miR-548b stem-loop
Gene family MIPF0000317; mir-548
Stem-loop
   caggcuau     u       ug               c  gg   uuuau 
5'         guauu agguugg  caaaaguaauugggg uu  gcc     u
           ||||| |||||||  ||||||||||||||| ||  |||      
3'         cauaa uccaacc  guuuucguuaacucc aa  cgg     u
   ------uu     -       gu               a  aa   uaacu 
Get sequence
Deep sequencing
1 reads, 0.122 reads per million, 5 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-548b

Accession MIMAT0006411
Sequence

61 - 

caaaaaccucaauugcuuuugu

 - 82

Get sequence
Evidence by similarity; MI0003596
Predicted targets

References

1