Stem-loop sequence mml-mir-548b

AccessionMI0007820
DescriptionMacaca mulatta miR-548b stem-loop
Gene family MIPF0000317; mir-548
Stem-loop
caggcuau     u       ug               c  gg   uuuau 
        guauu agguugg  caaaaguaauugggg uu  gcc     u
        ||||| |||||||  ||||||||||||||| ||  |||      
        cauaa uccaacc  guuuucguuaacucc aa  cgg     u
------uu     -       gu               a  aa   uaacu 
Get sequence
Deep sequencing
1 reads, 0.122 reads per million, 5 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-548b

Accession MIMAT0006411
Sequence

61 - 

caaaaaccucaauugcuuuugu

 - 82

Get sequence
Evidence by similarity; MI0003596
Predicted targets

References

1