Stem-loop sequence mml-mir-548b

AccessionMI0007820 (change log)
DescriptionMacaca mulatta miR-548b stem-loop
Gene family MIPF0000317; mir-548
Literature search

1 open access papers mention mml-mir-548b
(2 sentences)

Stem-loop
   caggcuau     u       ug               c  gg   uuuau 
5'         guauu agguugg  caaaaguaauugggg uu  gcc     u
           ||||| |||||||  ||||||||||||||| ||  |||      
3'         cauaa uccaacc  guuuucguuaacucc aa  cgg     u
   ------uu     -       gu               a  aa   uaacu 
Get sequence
Deep sequencing
376 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr4: 148755929-148756025 [+]
intergenic
Database links

Mature sequence mml-miR-548b

Accession MIMAT0006411
Sequence

61 - 

caaaaaccucaauugcuuuugu

 - 82

Get sequence
Deep sequencing6 reads, 4 experiments
Evidence by similarity; MI0003596
Predicted targets

References

1