Stem-loop sequence mml-mir-548b

Accession MI0007820
Description Macaca mulatta miR-548b stem-loop
Gene family MIPF0000317; mir-548
Stem-loop
caggcuau     u       ug               c  gg   uuuau 
        guauu agguugg  caaaaguaauugggg uu  gcc     u
        ||||| |||||||  ||||||||||||||| ||  |||      
        cauaa uccaacc  guuuucguuaacucc aa  cgg     u
------uu     -       gu               a  aa   uaacu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
4: 144912371-144912467 [+]
sense
ENSMMUT00000018677 ; FAM184A-201; intron 1
ENSMMUT00000018676 ; FAM184A-202; intron 1
ENSMMUT00000018674 ; FAM184A-203; intron 1
ENSMMUT00000039998 ; FAM184A-204; intron 1
Database links

Mature sequence mml-miR-548b

Accession MIMAT0006411
Sequence

61 - 

caaaaaccucaauugcuuuugu

 - 82

Get sequence
Evidence by similarity; MI0003596
Predicted targets

References

1