Stem-loop sequence mml-mir-548a

AccessionMI0007819 (change log)
DescriptionMacaca mulatta miR-548a stem-loop
Gene family MIPF0000317; mir-548
Stem-loop
   ---uc    gagguauuaag    u c            -   uuu   c     a 
5'      cagg           uugg g aaaaguaauugu ggu   uug cauua a
        ||||           |||| | |||||||||||| |||   ||| |||||  
3'      gucc           aacc c uuuucauuaacg uca   aac guaau a
   uuaua    ----------a    u c            g   --u   a     g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr4: 18983396-18983493 [+]
intergenic
Database links

Mature sequence mml-miR-548a

Accession MIMAT0006410
Sequence

62 - 

caauacuggcaauuacuuuucc

 - 83

Get sequence
Evidence by similarity; MI0003593
Predicted targets

References

1