Stem-loop sequence mml-mir-545

AccessionMI0007818 (change log)
DescriptionMacaca mulatta miR-545 stem-loop
Gene family MIPF0000098; mir-95
Stem-loop
   cccag    ------g   a         - u            a  a     auaaa 
5'      ccug       cac uuaguaggc c caguaaauguuu uu gauga     u
        ||||       ||| ||||||||| | |||||||||||| || |||||     g
3'      ggac       gug aaucguccg g guuauuuacaaa ga cuacu     a
   -----    accucga   a         u u            c  -     cagua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 68840424-68840529 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-545
mml-mir-374achrX: 68840608-68840679 [-]
mml-mir-545chrX: 68840424-68840529 [-]
Database links

Mature sequence mml-miR-545

Accession MIMAT0006409
Sequence

63 - 

ucagcaaacauuuauugugugc

 - 84

Get sequence
Evidence by similarity; MI0003516
Predicted targets

References

1