Stem-loop sequence mml-mir-545

AccessionMI0007818
DescriptionMacaca mulatta miR-545 stem-loop
Gene family MIPF0000098; mir-95
Stem-loop
cccag    ------g   a         - u            a  a     auaaa 
     ccug       cac uuaguaggc c caguaaauguuu uu gauga     u
     ||||       ||| ||||||||| | |||||||||||| || |||||     g
     ggac       gug aaucguccg g guuauuuacaaa ga cuacu     a
-----    accucga   a         u u            c  -     cagua 
Get sequence
Deep sequencing
38 reads, 1.52 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chrX: 73947273-73947378 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-545
mml-mir-374achrX: 73947457-73947528 [-]
mml-mir-545chrX: 73947273-73947378 [-]
Database links

Mature sequence mml-miR-545

Accession MIMAT0006409
Sequence

63 - 

ucagcaaacauuuauugugugc

 - 84

Get sequence
Evidence by similarity; MI0003516
Predicted targets

References

1