Stem-loop sequence mml-mir-544

Accession MI0007817
Description Macaca mulatta miR-544 stem-loop
Gene family MIPF0000436; mir-544
Stem-loop
auuuu      cua    u           -     u   -ga  c 
     caucac   ggga cuuguuaaaaa gcaga ucu   uu a
     ||||||   |||| ||||||||||| ||||| |||   ||  
     guagug   cucu gaacgauuuuu cgucu aga   ag g
uaauc      -aa    u           a     u   acc  g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164333144-164333234 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-544
mml-mir-376c 7: 164324189-164324254 [+]
mml-mir-376a-2 7: 164324567-164324646 [+]
mml-mir-654 7: 164324717-164324797 [+]
mml-mir-376b 7: 164324934-164325033 [+]
mml-mir-376a-1 7: 164325280-164325347 [+]
mml-mir-1185-2 7: 164327486-164327544 [+]
mml-mir-1185-1 7: 164328686-164328795 [+]
mml-mir-381 7: 164330417-164330491 [+]
mml-mir-487b 7: 164330952-164331035 [+]
mml-mir-539 7: 164331808-164331885 [+]
mml-mir-889 7: 164332385-164332463 [+]
mml-mir-544 7: 164333144-164333234 [+]
mml-mir-487a 7: 164336378-164336457 [+]
mml-mir-382 7: 164338233-164338308 [+]
mml-mir-134 7: 164338614-164338686 [+]
mml-mir-668 7: 164339183-164339248 [+]
mml-mir-485 7: 164339347-164339419 [+]
mml-mir-323b 7: 164340154-164340210 [+]
Database links

Mature sequence mml-miR-544

Accession MIMAT0006408
Sequence

55 - 

auucugcauuuuuagcaaguuc

 - 76

Get sequence
Evidence by similarity; MI0003515
Predicted targets

References

1