Stem-loop sequence mml-mir-544

Accession MI0007817
Description Macaca mulatta miR-544 stem-loop
Gene family MIPF0000436; mir-544
Stem-loop
   auuuu      cua    u           -     u   -ga  c 
5'      caucac   ggga cuuguuaaaaa gcaga ucu   uu a
        ||||||   |||| ||||||||||| ||||| |||   ||  
3'      guagug   cucu gaacgauuuuu cgucu aga   ag g
   uaauc      -aa    u           a     u   acc  g 
Get sequence
Deep sequencing
63 reads, 1.25 reads per million, 6 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164947069-164947159 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-544
mml-mir-376c chr7: 164938114-164938179 [+]
mml-mir-376a-2 chr7: 164938492-164938571 [+]
mml-mir-654 chr7: 164938642-164938722 [+]
mml-mir-376b chr7: 164938859-164938958 [+]
mml-mir-376a-1 chr7: 164939205-164939272 [+]
mml-mir-1185-2 chr7: 164941410-164941468 [+]
mml-mir-1185-1 chr7: 164942609-164942718 [+]
mml-mir-381 chr7: 164944340-164944414 [+]
mml-mir-487b chr7: 164944875-164944958 [+]
mml-mir-539 chr7: 164945731-164945808 [+]
mml-mir-889 chr7: 164946308-164946386 [+]
mml-mir-544 chr7: 164947069-164947159 [+]
mml-mir-487a chr7: 164950883-164950962 [+]
mml-mir-382 chr7: 164952738-164952813 [+]
mml-mir-134 chr7: 164953119-164953191 [+]
mml-mir-668 chr7: 164953688-164953753 [+]
mml-mir-485 chr7: 164953852-164953924 [+]
mml-mir-323b chr7: 164954659-164954715 [+]
Database links

Mature sequence mml-miR-544

Accession MIMAT0006408
Sequence

55 - 

auucugcauuuuuagcaaguuc

 - 76

Get sequence
Evidence by similarity; MI0003515
Predicted targets

References

1