Stem-loop sequence mml-mir-544

AccessionMI0007817 (change log)
DescriptionMacaca mulatta miR-544 stem-loop
Gene family MIPF0000436; mir-544
Stem-loop
   auuuu      cua    u           -     u   -ga  c 
5'      caucac   ggga cuuguuaaaaa gcaga ucu   uu a
        ||||||   |||| ||||||||||| ||||| |||   ||  
3'      guagug   cucu gaacgauuuuu cgucu aga   ag g
   uaauc      -aa    u           a     u   acc  g 
Get sequence
Deep sequencing
243 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163382652-163382742 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-544
mml-mir-376cchr7: 163373697-163373762 [+]
mml-mir-376a-2chr7: 163374075-163374154 [+]
mml-mir-654chr7: 163374225-163374305 [+]
mml-mir-376bchr7: 163374442-163374541 [+]
mml-mir-376a-1chr7: 163374788-163374855 [+]
mml-mir-1185-2chr7: 163376994-163377052 [+]
mml-mir-1185-1chr7: 163378194-163378303 [+]
mml-mir-381chr7: 163379925-163379999 [+]
mml-mir-487bchr7: 163380460-163380543 [+]
mml-mir-539chr7: 163381316-163381393 [+]
mml-mir-889chr7: 163381893-163381971 [+]
mml-mir-544chr7: 163382652-163382742 [+]
mml-mir-487achr7: 163386465-163386544 [+]
mml-mir-382chr7: 163388320-163388395 [+]
mml-mir-134chr7: 163388701-163388773 [+]
mml-mir-668chr7: 163389270-163389335 [+]
mml-mir-485chr7: 163389434-163389506 [+]
mml-mir-323bchr7: 163390241-163390297 [+]
Database links

Mature sequence mml-miR-544

Accession MIMAT0006408
Sequence

55 - 

auucugcauuuuuagcaaguuc

 - 76

Get sequence
Deep sequencing48 reads, 5 experiments
Evidence by similarity; MI0003515
Predicted targets

References

1