Stem-loop sequence mml-mir-542

AccessionMI0007816 (change log)
DescriptionMacaca mulatta miR-542 stem-loop
Gene family MIPF0000185; mir-542
Stem-loop
   ----------cagac       auc    gg    uca         -a   c 
5'                cucagac   ucgg  auca   ugucacgag  uac a
                  |||||||   ||||  ||||   |||||||||  |||  
3'                gggucug   aguc  uagu   acaguguuc  gug c
   acuucuacuuaccga       gaa    aa    uag         ac   u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 128513131-128513227 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-542
mml-mir-424chrX: 128518416-128518513 [-]
mml-mir-503chrX: 128518109-128518179 [-]
mml-mir-542chrX: 128513131-128513227 [-]
mml-mir-450a-2chrX: 128512304-128512403 [-]
mml-mir-450a-1chrX: 128512137-128512227 [-]
mml-mir-450bchrX: 128511981-128512058 [-]
Database links

Mature sequence mml-miR-542-5p

Accession MIMAT0006406
Sequence

16 - 

ucggggaucaucaugucacgaga

 - 38

Get sequence
Evidence by similarity; MI0003686
Predicted targets

Mature sequence mml-miR-542-3p

Accession MIMAT0006407
Sequence

53 - 

ugugacagauugauaacugaaa

 - 74

Get sequence
Evidence by similarity; MI0003686
Predicted targets

References

1