Stem-loop sequence mml-mir-542

Accession MI0007816
Description Macaca mulatta miR-542 stem-loop
Gene family MIPF0000185; mir-542
Stem-loop
----------cagac       auc    gg    uca         -a   c 
               cucagac   ucgg  auca   ugucacgag  uac a
               |||||||   ||||  ||||   |||||||||  |||  
               gggucug   aguc  uagu   acaguguuc  gug c
acuucuacuuaccga       gaa    aa    uag         ac   u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 132766718-132766814 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-542
mml-mir-424 X: 132772003-132772100 [-]
mml-mir-503 X: 132771696-132771766 [-]
mml-mir-542 X: 132766718-132766814 [-]
mml-mir-450a-2 X: 132765891-132765990 [-]
mml-mir-450a-1 X: 132765724-132765814 [-]
mml-mir-450b X: 132765568-132765645 [-]
Database links

Mature sequence mml-miR-542-5p

Accession MIMAT0006406
Sequence

16 - 

ucggggaucaucaugucacgaga

 - 38

Get sequence
Evidence by similarity; MI0003686
Predicted targets

Mature sequence mml-miR-542-3p

Accession MIMAT0006407
Sequence

53 - 

ugugacagauugauaacugaaa

 - 74

Get sequence
Evidence by similarity; MI0003686
Predicted targets

References

1