Stem-loop sequence mml-mir-542

Accession MI0007816
Description Macaca mulatta miR-542 stem-loop
Gene family MIPF0000185; mir-542
Stem-loop
   ----------cagac       auc    gg    uca         -a   c 
5'                cucagac   ucgg  auca   ugucacgag  uac a
                  |||||||   ||||  ||||   |||||||||  |||  
3'                gggucug   aguc  uagu   acaguguuc  gug c
   acuucuacuuaccga       gaa    aa    uag         ac   u 
Get sequence
Deep sequencing
8067 reads, 631 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chrX: 133863537-133863633 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-542
mml-mir-503 chrX: 133868518-133868588 [-]
mml-mir-542 chrX: 133863537-133863633 [-]
mml-mir-450a-2 chrX: 133862710-133862809 [-]
mml-mir-450a-1 chrX: 133862543-133862633 [-]
Database links

Mature sequence mml-miR-542-5p

Accession MIMAT0006406
Sequence

16 - 

ucggggaucaucaugucacgaga

 - 38

Get sequence
Deep sequencing 2 reads, 1 experiments
Evidence by similarity; MI0003686
Predicted targets

Mature sequence mml-miR-542-3p

Accession MIMAT0006407
Sequence

53 - 

ugugacagauugauaacugaaa

 - 74

Get sequence
Deep sequencing 9 reads, 4 experiments
Evidence by similarity; MI0003686
Predicted targets

References

1