Stem-loop sequence mml-mir-539

AccessionMI0007815
DescriptionMacaca mulatta miR-539 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
     ug          a      g    -    - uuu 
auacu  aggagaaauu uccuug ugug uucg c   a
|||||  |||||||||| |||||| |||| |||| |   u
uauga  uuuucuuuaa aggaac auac aagu g   u
     gu          c      -    u    a uau 
Get sequence
Deep sequencing
772 reads, 11.3 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164945731-164945808 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-539
mml-mir-376cchr7: 164938114-164938179 [+]
mml-mir-376a-2chr7: 164938492-164938571 [+]
mml-mir-654chr7: 164938642-164938722 [+]
mml-mir-376bchr7: 164938859-164938958 [+]
mml-mir-376a-1chr7: 164939205-164939272 [+]
mml-mir-1185-2chr7: 164941410-164941468 [+]
mml-mir-1185-1chr7: 164942609-164942718 [+]
mml-mir-381chr7: 164944340-164944414 [+]
mml-mir-487bchr7: 164944875-164944958 [+]
mml-mir-539chr7: 164945731-164945808 [+]
mml-mir-889chr7: 164946308-164946386 [+]
mml-mir-544chr7: 164947069-164947159 [+]
mml-mir-487achr7: 164950883-164950962 [+]
mml-mir-382chr7: 164952738-164952813 [+]
mml-mir-134chr7: 164953119-164953191 [+]
mml-mir-668chr7: 164953688-164953753 [+]
mml-mir-485chr7: 164953852-164953924 [+]
mml-mir-323bchr7: 164954659-164954715 [+]
Database links

Mature sequence mml-miR-539

Accession MIMAT0006405
Sequence

9 - 

ggagaaauuauccuuggugugu

 - 30

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence by similarity; MI0003514
Predicted targets

References

1