Stem-loop sequence mml-mir-532

Accession MI0007814
Description Macaca mulatta miR-532 stem-loop
Gene family MIPF0000113; mir-188
Stem-loop
cgacuugcuuucucuccuc  u      a    a   cc  uggca 
                   ca gccuug gugu gga  gu     u
                   || |||||| |||| |||  ||     c
                   gu cggaac caca ccu  ca     u
-----------------ac  u      c    c   cc  uuaau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 47638245-47638322 [+]
sense
ENSMMUT00000032444 ; CLCN5-201; intron 3
Clustered miRNAs
< 10kb from mml-mir-532
mml-mir-532 X: 47638245-47638322 [+]
mml-mir-188 X: 47638603-47638688 [+]
mml-mir-500a X: 47643501-47643584 [+]
mml-mir-362 X: 47644032-47644096 [+]
mml-mir-501 X: 47644792-47644875 [+]
mml-mir-500b X: 47647191-47647251 [+]
Database links

Mature sequence mml-miR-532-5p

Accession MIMAT0006403
Sequence

20 - 

caugccuugaguguaggaccgu

 - 41

Get sequence
Evidence by similarity; MI0003205
Predicted targets

Mature sequence mml-miR-532-3p

Accession MIMAT0006404
Sequence

57 - 

ccucccacacccaaggcuugca

 - 78

Get sequence
Evidence by similarity; MI0003205
Predicted targets

References

1