|
miRBase |
|
Stem-loop sequence mml-mir-532 |
||||||||||||
| Accession | MI0007814 | |||||||||||
| Description | Macaca mulatta miR-532 stem-loop | |||||||||||
| Gene family | MIPF0000113; mir-188 | |||||||||||
| Stem-loop |
cgacuugcuuucucuccuc u a a cc uggca ca gccuug gugu gga gu u || |||||| |||| ||| || c gu cggaac caca ccu ca u -----------------ac u c c cc uuaau |
|||||||||||
| Genome context |
|
|||||||||||
| Clustered miRNAs |
|
|||||||||||
| Database links |
|
|||||||||||
Mature sequence mml-miR-532-5p |
|
| Accession | MIMAT0006403 |
| Sequence |
20 - caugccuugaguguaggaccgu - 41 |
| Evidence | by similarity; MI0003205 |
| Predicted targets |
|
Mature sequence mml-miR-532-3p |
|
| Accession | MIMAT0006404 |
| Sequence |
57 - ccucccacacccaaggcuugca - 78 |
| Evidence | by similarity; MI0003205 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|