Stem-loop sequence mml-mir-532

AccessionMI0007814 (change log)
DescriptionMacaca mulatta miR-532 stem-loop
Gene family MIPF0000113; mir-188
Stem-loop
   cgacuugcuuucucuccuc  u      a    a   cc  uggca 
5'                    ca gccuug gugu gga  gu     u
                      || |||||| |||| |||  ||     c
3'                    gu cggaac caca ccu  ca     u
   -----------------ac  u      c    c   cc  uuaau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 50008220-50008297 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-532
mml-mir-532chrX: 50008220-50008297 [+]
mml-mir-188chrX: 50008578-50008663 [+]
mml-mir-500achrX: 50013494-50013577 [+]
mml-mir-362chrX: 50014025-50014089 [+]
mml-mir-501chrX: 50014785-50014868 [+]
mml-mir-500bchrX: 50017286-50017346 [+]
Database links

Mature sequence mml-miR-532-5p

Accession MIMAT0006403
Sequence

20 - 

caugccuugaguguaggaccgu

 - 41

Get sequence
Evidence by similarity; MI0003205
Database links
Predicted targets

Mature sequence mml-miR-532-3p

Accession MIMAT0006404
Sequence

57 - 

ccucccacacccaaggcuugca

 - 78

Get sequence
Evidence by similarity; MI0003205
Predicted targets

References

1