Stem-loop sequence mml-mir-532

Accession MI0007814
Description Macaca mulatta miR-532 stem-loop
Gene family MIPF0000113; mir-188
Stem-loop
   cgacuugcuuucucuccuc  u      a    a   cc  uggca 
5'                    ca gccuug gugu gga  gu     u
                      || |||||| |||| |||  ||     c
3'                    gu cggaac caca ccu  ca     u
   -----------------ac  u      c    c   cc  uuaau 
Get sequence
Deep sequencing
3081 reads, 116 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
JH290886.1: 33403-33480 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-532
mml-mir-532 JH290886.1: 33403-33480 [+]
mml-mir-188 JH290886.1: 33761-33846 [+]
mml-mir-500a JH290886.1: 38665-38748 [+]
mml-mir-362 JH290886.1: 39196-39260 [+]
mml-mir-501 JH290886.1: 39956-40039 [+]
mml-mir-500b JH290886.1: 42676-42736 [+]
Database links

Mature sequence mml-miR-532-5p

Accession MIMAT0006403
Sequence

20 - 

caugccuugaguguaggaccgu

 - 41

Get sequence
Deep sequencing 18 reads, 5 experiments
Evidence by similarity; MI0003205
Predicted targets

Mature sequence mml-miR-532-3p

Accession MIMAT0006404
Sequence

57 - 

ccucccacacccaaggcuugca

 - 78

Get sequence
Deep sequencing 2 reads, 2 experiments
Evidence by similarity; MI0003205
Predicted targets

References

1