Stem-loop sequence mml-mir-525

AccessionMI0007813 (change log)
DescriptionMacaca mulatta miR-525 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
                u              a         a gu 
5' cucaggcugugac cuccagagggaugc cuuucuuuu u  g
   ||||||||||||| |||||||||||||| ||||||||| |   
3' ggguuuggcauug gagguuucccuacg ggaagaaaa a  a
                c              c         a aa 
Get sequence
Deep sequencing
191 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49042145-49042230 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-525
mml-mir-1283chr19: 49032979-49033088 [+]
mml-mir-520achr19: 49034604-49034688 [+]
mml-mir-526bchr19: 49038951-49039033 [+]
mml-mir-519a-2chr19: 49039745-49039863 [+]
mml-mir-525chr19: 49042145-49042230 [+]
mml-mir-523achr19: 49042991-49043077 [+]
mml-mir-518fchr19: 49044960-49045046 [+]
mml-mir-519achr19: 49046135-49046219 [+]
mml-mir-518bchr19: 49048495-49048577 [+]
Database links

Mature sequence mml-miR-525

Accession MIMAT0006402
Sequence

15 - 

cuccagagggaugcacuuucu

 - 35

Get sequence
Deep sequencing67 reads, 3 experiments
Evidence by similarity; MI0003152
Predicted targets

References

1