Stem-loop sequence mml-mir-523b

AccessionMI0007810 (change log)
DescriptionMacaca mulatta miR-523b stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
        uga      c        c               ggcu 
5' ucuca   ugugac cucuagag gaagcgcuuucuguu    a
   |||||   |||||| |||||||| |||||||||||||||    g
3' agagu   gcauug gagauuuc cuucgcgaaggauaa    a
        uuc      u        c               gaaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49080348-49080436 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-523b
mml-mir-518d-1chr19: 49073236-49073345 [+]
mml-mir-518gchr19: 49075909-49075967 [+]
mml-mir-518d-2chr19: 49077769-49077827 [+]
mml-mir-523bchr19: 49080348-49080436 [+]
mml-mir-516bchr19: 49089836-49089925 [+]
Database links

Mature sequence mml-miR-523b

Accession MIMAT0006400
Sequence

16 - 

cucuagagcgaagcgcuuucug

 - 37

Get sequence
Evidence by similarity; MI0003169
Predicted targets

References

1