Stem-loop sequence mml-mir-523b

Accession MI0007810
Description Macaca mulatta miR-523b stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
     uga      c        c               ggcu 
ucuca   ugugac cucuagag gaagcgcuuucuguu    a
|||||   |||||| |||||||| |||||||||||||||    g
agagu   gcauug gagauuuc cuucgcgaaggauaa    a
     uuc      u        c               gaaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 59835044-59835132 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-523b
mml-mir-518d-1 19: 59827928-59828037 [+]
mml-mir-518g 19: 59830601-59830659 [+]
mml-mir-518d-2 19: 59832465-59832523 [+]
mml-mir-523b 19: 59835044-59835132 [+]
mml-mir-516b 19: 59844519-59844608 [+]
Database links

Mature sequence mml-miR-523b

Accession MIMAT0006400
Sequence

16 - 

cucuagagcgaagcgcuuucug

 - 37

Get sequence
Evidence by similarity; MI0003169
Predicted targets

References

1