Stem-loop sequence mml-mir-523b

AccessionMI0007810
DescriptionMacaca mulatta miR-523b stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
     uga      c        c               ggcu 
ucuca   ugugac cucuagag gaagcgcuuucuguu    a
|||||   |||||| |||||||| |||||||||||||||    g
agagu   gcauug gagauuuc cuucgcgaaggauaa    a
     uuc      u        c               gaaa 
Get sequence
Deep sequencing
14 reads, 10.7 reads per million, 2 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr19: 59566410-59566498 [+]
intergenic
Database links

Mature sequence mml-miR-523b

Accession MIMAT0006400
Sequence

16 - 

cucuagagcgaagcgcuuucug

 - 37

Get sequence
Evidence by similarity; MI0003169
Predicted targets

References

1