|
miRBase |
|
Stem-loop sequence mml-mir-523b |
||||||||
| Accession | MI0007810 | |||||||
| Description | Macaca mulatta miR-523b stem-loop | |||||||
| Gene family | MIPF0000020; mir-515 | |||||||
| Stem-loop |
uga c c ggcu ucuca ugugac cucuagag gaagcgcuuucuguu a ||||| |||||| |||||||| ||||||||||||||| g agagu gcauug gagauuuc cuucgcgaaggauaa a uuc u c gaaa |
|||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
| Database links |
|
|||||||
Mature sequence mml-miR-523b |
|
| Accession | MIMAT0006400 |
| Sequence |
16 - cucuagagcgaagcgcuuucug - 37 |
| Evidence | by similarity; MI0003169 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|