Stem-loop sequence mml-mir-523a

AccessionMI0007809
DescriptionMacaca mulatta miR-523a stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
       cu                    a u    guug  u 
ucucagg  gugacccucuagagggaagc c uucu    uc g
|||||||  |||||||||||||||||||| | ||||    || g
agagucu  cauugggagauuucccuucg g aaga    ag a
       cu                    c u    --aa  a 
Get sequence
Deep sequencing
130 reads, 57.4 reads per million, 5 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr19: 59527025-59527111 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-523a
mml-mir-520achr19: 59518714-59518798 [+]
mml-mir-526bchr19: 59522999-59523081 [+]
mml-mir-519a-2chr19: 59523792-59523910 [+]
mml-mir-523achr19: 59527025-59527111 [+]
mml-mir-518fchr19: 59528995-59529081 [+]
mml-mir-519achr19: 59530409-59530493 [+]
mml-mir-518bchr19: 59532765-59532847 [+]
Database links

Mature sequence mml-miR-523a

Accession MIMAT0006399
Sequence

54 - 

aaugcgcuucccuuuagaggg

 - 74

Get sequence
Evidence by similarity; MI0003153
Predicted targets

References

1