Stem-loop sequence mml-mir-523a

AccessionMI0007809 (change log)
DescriptionMacaca mulatta miR-523a stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
          cu                    a u    guug  u 
5' ucucagg  gugacccucuagagggaagc c uucu    uc g
   |||||||  |||||||||||||||||||| | ||||    || g
3' agagucu  cauugggagauuucccuucg g aaga    ag a
          cu                    c u    --aa  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49042991-49043077 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-523a
mml-mir-520achr19: 49034604-49034688 [+]
mml-mir-526bchr19: 49038951-49039033 [+]
mml-mir-519a-2chr19: 49039745-49039863 [+]
mml-mir-525chr19: 49042145-49042230 [+]
mml-mir-523achr19: 49042991-49043077 [+]
mml-mir-518fchr19: 49044960-49045046 [+]
mml-mir-519achr19: 49046135-49046219 [+]
mml-mir-518bchr19: 49048495-49048577 [+]
Database links

Mature sequence mml-miR-523a

Accession MIMAT0006399
Sequence

54 - 

aaugcgcuucccuuuagaggg

 - 74

Get sequence
Evidence by similarity; MI0003153
Predicted targets

References

1