Stem-loop sequence mml-mir-523a

Accession MI0007809
Description Macaca mulatta miR-523a stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
       cu                    a u    guug  u 
ucucagg  gugacccucuagagggaagc c uucu    uc g
|||||||  |||||||||||||||||||| | ||||    || g
agagucu  cauugggagauuucccuucg g aaga    ag a
       cu                    c u    --aa  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 59798513-59798599 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-523a
mml-mir-520a 19: 59789775-59789859 [+]
mml-mir-526b 19: 59794473-59794555 [+]
mml-mir-525 19: 59797667-59797752 [+]
mml-mir-523a 19: 59798513-59798599 [+]
mml-mir-518f 19: 59800483-59800569 [+]
mml-mir-519a 19: 59801658-59801742 [+]
mml-mir-518b 19: 59804018-59804100 [+]
Database links

Mature sequence mml-miR-523a

Accession MIMAT0006399
Sequence

54 - 

aaugcgcuucccuuuagaggg

 - 74

Get sequence
Evidence by similarity; MI0003153
Predicted targets

References

1