Stem-loop sequence mml-mir-521

AccessionMI0007807 (change log)
DescriptionMacaca mulatta miR-521 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
        u  u     c              a u    guug  u 
5' ucuca gc gugac cuccaaagggaagu c uucu    uc a
   ||||| || ||||| |||||||||||||| | ||||    || a
3' agagu ug cauug gagguuucccuuca g aaga    ag a
        u  c     u              c c    --aa  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49104021-49104107 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-521
mml-mir-517cchr19: 49094936-49095046 [+]
mml-mir-519bchr19: 49102330-49102410 [+]
mml-mir-521chr19: 49104021-49104107 [+]
mml-mir-518echr19: 49105593-49105679 [+]
mml-mir-518a-2chr19: 49108097-49108155 [+]
mml-mir-516a-1chr19: 49109628-49109716 [+]
Database links

Mature sequence mml-miR-521

Accession MIMAT0006397
Sequence

54 - 

aacgcacuucccuuuggagugu

 - 75

Get sequence
Evidence by similarity; MI0003176
Predicted targets

References

1