Stem-loop sequence mml-mir-521

Accession MI0007807
Description Macaca mulatta miR-521 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
     u  u     c              a u    guug  u 
ucuca gc gugac cuccaaagggaagu c uucu    uc a
||||| || ||||| |||||||||||||| | ||||    || a
agagu ug cauug gagguuucccuuca g aaga    ag a
     u  c     u              c c    --aa  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 59858727-59858813 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-521
mml-mir-517c 19: 59849807-59849917 [+]
mml-mir-519b 19: 59857036-59857116 [+]
mml-mir-521 19: 59858727-59858813 [+]
mml-mir-518e 19: 59860299-59860385 [+]
mml-mir-518a-2 19: 59862803-59862861 [+]
mml-mir-516a-1 19: 59864334-59864422 [+]
Database links

Mature sequence mml-miR-521

Accession MIMAT0006397
Sequence

54 - 

aacgcacuucccuuuggagugu

 - 75

Get sequence
Evidence by similarity; MI0003176
Predicted targets

References

1