Stem-loop sequence mml-mir-521

Accession MI0007807
Description Macaca mulatta miR-521 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
        u  u     c              a u    guug  u 
5' ucuca gc gugac cuccaaagggaagu c uucu    uc a
   ||||| || ||||| |||||||||||||| | ||||    || a
3' agagu ug cauug gagguuucccuuca g aaga    ag a
        u  c     u              c c    --aa  a 
Get sequence
Deep sequencing
1 reads, 1.28 reads per million, 1 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr19: 59590923-59591009 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-521
mml-mir-524 chr19: 59544889-59544973 [+]
mml-mir-517c chr19: 59581913-59582023 [+]
mml-mir-519b chr19: 59589147-59589227 [+]
mml-mir-521 chr19: 59590923-59591009 [+]
mml-mir-518e chr19: 59592493-59592579 [+]
mml-mir-524 chr19: 59594913-59594997 [+]
mml-mir-516a-1 chr19: 59596267-59596355 [+]
Database links

Mature sequence mml-miR-521

Accession MIMAT0006397
Sequence

54 - 

aacgcacuucccuuuggagugu

 - 75

Get sequence
Evidence by similarity; MI0003176
Predicted targets

References

1