Stem-loop sequence mml-mir-520g

AccessionMI0007805 (change log)
DescriptionMacaca mulatta miR-520g stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
        u  u  g  c    ag  -a        uc     guug  u 
5' uccca gc gu gc cucu  ag  aagcacuu  uguuu    uc g
   ||||| || || || ||||  ||  ||||||||  |||||    ||  
3' agggu ug cg ug gaga  uc  uucgugaa  acaaa    ag a
        u  u  g  u    cu  cc        --     ---a  g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49068463-49068552 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-520g
mml-mir-517achr19: 49059963-49060048 [+]
mml-mir-519dchr19: 49061111-49061201 [+]
mml-mir-518a-1chr19: 49066416-49066502 [+]
mml-mir-520gchr19: 49068463-49068552 [+]
mml-mir-518d-1chr19: 49073236-49073345 [+]
mml-mir-518gchr19: 49075909-49075967 [+]
mml-mir-518d-2chr19: 49077769-49077827 [+]
Database links

Mature sequence mml-miR-520g

Accession MIMAT0006395
Sequence

55 - 

acaaagugcuucccuucagagugu

 - 78

Get sequence
Evidence by similarity; MI0003166
Predicted targets

References

1