Stem-loop sequence mml-mir-520g

AccessionMI0007805
DescriptionMacaca mulatta miR-520g stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
     u  u  g  c    ag  -a        uc     guug  u 
uccca gc gu gc cucu  ag  aagcacuu  uguuu    uc g
||||| || || || ||||  ||  ||||||||  |||||    ||  
agggu ug cg ug gaga  uc  uucgugaa  acaaa    ag a
     u  u  g  u    cu  cc        --     ---a  g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-520g

Accession MIMAT0006395
Sequence

55 - 

acaaagugcuucccuucagagugu

 - 78

Get sequence
Evidence by similarity; MI0003166
Predicted targets

References

1