Stem-loop sequence mml-mir-520g

Accession MI0007805
Description Macaca mulatta miR-520g stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
     u  u  g  c    ag  -a        uc     guug  u 
uccca gc gu gc cucu  ag  aagcacuu  uguuu    uc g
||||| || || || ||||  ||  ||||||||  |||||    ||  
agggu ug cg ug gaga  uc  uucgugaa  acaaa    ag a
     u  u  g  u    cu  cc        --     ---a  g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 59823753-59823842 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-520g
mml-mir-517a 19: 59815178-59815263 [+]
mml-mir-519d 19: 59816326-59816416 [+]
mml-mir-518a-1 19: 59821546-59821632 [+]
mml-mir-520g 19: 59823753-59823842 [+]
mml-mir-518d-1 19: 59827928-59828037 [+]
mml-mir-518g 19: 59830601-59830659 [+]
mml-mir-518d-2 19: 59832465-59832523 [+]
Database links

Mature sequence mml-miR-520g

Accession MIMAT0006395
Sequence

55 - 

acaaagugcuucccuucagagugu

 - 78

Get sequence
Evidence by similarity; MI0003166
Predicted targets

References

1