Stem-loop sequence mml-mir-520a

AccessionMI0007799 (change log)
DescriptionMacaca mulatta miR-520a stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
            u   cc                    guug  u 
5' cucaggcug gac  uccagagggaaguauuuucu    uc g
   ||||||||| |||  ||||||||||||||||||||    || a
3' gaguuuggc uug  agguuucccuucgugaaaga    ag a
            u   uc                    --aa  g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49034604-49034688 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-520a
mml-mir-519echr19: 49028305-49028414 [+]
mml-mir-519cchr19: 49030112-49030198 [+]
mml-mir-1283chr19: 49032979-49033088 [+]
mml-mir-520achr19: 49034604-49034688 [+]
mml-mir-526bchr19: 49038951-49039033 [+]
mml-mir-519a-2chr19: 49039745-49039863 [+]
mml-mir-525chr19: 49042145-49042230 [+]
mml-mir-523achr19: 49042991-49043077 [+]
Database links

Mature sequence mml-miR-520a-5p

Accession MIMAT0026896
Sequence

16 - 

uccagagggaaguauuuucu

 - 35

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-520a-3p

Accession MIMAT0006388
Sequence

53 - 

aaagugcuucccuuuggacugu

 - 74

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).