Stem-loop sequence mml-mir-520a

Accession MI0007799
Description Macaca mulatta miR-520a stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
         u   cc                    guug  u 
cucaggcug gac  uccagagggaaguauuuucu    uc g
||||||||| |||  ||||||||||||||||||||    || a
gaguuuggc uug  agguuucccuucgugaaaga    ag a
         u   uc                    --aa  g 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 59789775-59789859 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-520a
mml-mir-519e 19: 59783535-59783644 [+]
mml-mir-519c 19: 59785342-59785428 [+]
mml-mir-1283 19: 59788209-59788318 [+]
mml-mir-520a 19: 59789775-59789859 [+]
mml-mir-526b 19: 59794473-59794555 [+]
mml-mir-525 19: 59797667-59797752 [+]
mml-mir-523a 19: 59798513-59798599 [+]
Database links

Mature sequence mml-miR-520a-5p

Accession MIMAT0026896
Sequence

16 - 

uccagagggaaguauuuucu

 - 35

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-520a-3p

Accession MIMAT0006388
Sequence

53 - 

aaagugcuucccuuuggacugu

 - 74

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).