Stem-loop sequence mml-mir-520a

Accession MI0007799
Description Macaca mulatta miR-520a stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
            u   cc                    guug  u 
5' cucaggcug gac  uccagagggaaguauuuucu    uc g
   ||||||||| |||  ||||||||||||||||||||    || a
3' gaguuuggc uug  agguuucccuucgugaaaga    ag a
            u   uc                    --aa  g 
Get sequence
Deep sequencing
964 reads, 518 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr19: 59518714-59518798 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-520a
mml-mir-519c chr19: 59513903-59513989 [+]
mml-mir-1283 chr19: 59516766-59516875 [+]
mml-mir-520a chr19: 59518714-59518798 [+]
mml-mir-526b chr19: 59522999-59523081 [+]
mml-mir-519a-2 chr19: 59523792-59523910 [+]
mml-mir-523a chr19: 59527025-59527111 [+]
Database links

Mature sequence mml-miR-520a-5p

Accession MIMAT0026896
Sequence

16 - 

uccagagggaaguauuuucu

 - 35

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mml-miR-520a-3p

Accession MIMAT0006388
Sequence

53 - 

aaagugcuucccuuuggacugu

 - 74

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).