Stem-loop sequence mml-mir-519d

Accession MI0007798
Description Macaca mulatta miR-519d stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
        u  g  c   c               cug   g  gu 
ucccaagc gu ac cuc aaagggaagcacuuu   uuu uu  c
|||||||| || || ||| |||||||||||||||   ||| ||   
aggguucg ca ug gag uuuuccuucgugaaa   aaa ag  u
        c  g  u   a               -ca   g  ag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 59816326-59816416 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-519d
mml-mir-518c 19: 59811368-59811468 [+]
mml-mir-524 19: 59813163-59813247 [+]
mml-mir-517a 19: 59815178-59815263 [+]
mml-mir-519d 19: 59816326-59816416 [+]
mml-mir-518a-1 19: 59821546-59821632 [+]
mml-mir-520g 19: 59823753-59823842 [+]
Database links

Mature sequence mml-miR-519d

Accession MIMAT0006387
Sequence

57 - 

caaagugcuuccuuuuagagug

 - 78

Get sequence
Evidence by similarity; MI0003166
Predicted targets

References

1