Stem-loop sequence mml-mir-519d

Accession MI0007798
Description Macaca mulatta miR-519d stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
           u  g  c   c               cug   g  gu 
5' ucccaagc gu ac cuc aaagggaagcacuuu   uuu uu  c
   |||||||| || || ||| |||||||||||||||   ||| ||   
3' aggguucg ca ug gag uuuuccuucgugaaa   aaa ag  u
           c  g  u   a               -ca   g  ag 
Get sequence
Deep sequencing
10 reads, 8.14 reads per million, 2 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr19: 59548064-59548154 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-519d
mml-mir-518c chr19: 59543005-59543105 [+]
mml-mir-524 chr19: 59544889-59544973 [+]
mml-mir-517a chr19: 59546917-59547002 [+]
mml-mir-519d chr19: 59548064-59548154 [+]
mml-mir-518a-1 chr19: 59553030-59553116 [+]
mml-mir-524 chr19: 59594913-59594997 [+]
Database links

Mature sequence mml-miR-519d

Accession MIMAT0006387
Sequence

57 - 

caaagugcuuccuuuuagagug

 - 78

Get sequence
Evidence by similarity; MI0003166
Predicted targets

References

1