Stem-loop sequence mml-mir-519c

AccessionMI0007797 (change log)
DescriptionMacaca mulatta miR-519c stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
         u      c         g  a         guug   g 
5' ucucag cuguga ccucuagaa ga gcacuuucu    uuu a
   |||||| |||||| ||||||||| || |||||||||    |||  
3' agaguu gacauu ggagauuuu cu cgugaaaga    aag a
         u      a         a  a         ---a   a 
Get sequence
Deep sequencing
240 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49030112-49030198 [+]
sense
ENSMMUT00000038372 ; 3'UTR (exon 1)
Clustered miRNAs
< 10kb from mml-mir-519c
mml-mir-498chr19: 49021679-49021802 [+]
mml-mir-519echr19: 49028305-49028414 [+]
mml-mir-519cchr19: 49030112-49030198 [+]
mml-mir-1283chr19: 49032979-49033088 [+]
mml-mir-520achr19: 49034604-49034688 [+]
mml-mir-526bchr19: 49038951-49039033 [+]
mml-mir-519a-2chr19: 49039745-49039863 [+]
Database links

Mature sequence mml-miR-519c

Accession MIMAT0006386
Sequence

54 - 

aaagugcaucauuuuagaggau

 - 75

Get sequence
Deep sequencing195 reads, 3 experiments
Evidence by similarity; MI0003148
Predicted targets

References

1