Stem-loop sequence mml-mir-519b

AccessionMI0007796 (change log)
DescriptionMacaca mulatta miR-519b stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   caugcu                 a    u    guug  u 
5'       gugacccucuggaggga gcgc uucu    uc g
         ||||||||||||||||| |||| ||||    || a
3'       cauugggagauuucccu cgug aaga    ag a
   guuucu                 a    c    --aa  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49102330-49102410 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-519b
mml-mir-518a-3chr19: 49092967-49093085 [+]
mml-mir-517cchr19: 49094936-49095046 [+]
mml-mir-519bchr19: 49102330-49102410 [+]
mml-mir-521chr19: 49104021-49104107 [+]
mml-mir-518echr19: 49105593-49105679 [+]
mml-mir-518a-2chr19: 49108097-49108155 [+]
mml-mir-516a-1chr19: 49109628-49109716 [+]
Database links

Mature sequence mml-miR-519b

Accession MIMAT0006385
Sequence

51 - 

aacgugcaucccuuuagaggguu

 - 73

Get sequence
Evidence by similarity; MI0003153
Predicted targets

References

1