Stem-loop sequence mml-mir-519b

Accession MI0007796
Description Macaca mulatta miR-519b stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
caugcu                 a    u    guug  u 
      gugacccucuggaggga gcgc uucu    uc g
      ||||||||||||||||| |||| ||||    || a
      cauugggagauuucccu cgug aaga    ag a
guuucu                 a    c    --aa  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 59857036-59857116 [+]
sense
ENSMMUT00000049042 ; mml-mir-519b-201; exon 1
Clustered miRNAs
< 10kb from mml-mir-519b
mml-mir-517c 19: 59849807-59849917 [+]
mml-mir-519b 19: 59857036-59857116 [+]
mml-mir-521 19: 59858727-59858813 [+]
mml-mir-518e 19: 59860299-59860385 [+]
mml-mir-518a-2 19: 59862803-59862861 [+]
mml-mir-516a-1 19: 59864334-59864422 [+]
Database links

Mature sequence mml-miR-519b

Accession MIMAT0006385
Sequence

51 - 

aacgugcaucccuuuagaggguu

 - 73

Get sequence
Evidence by similarity; MI0003153
Predicted targets

References

1