Stem-loop sequence mml-mir-519a

DescriptionMacaca mulatta miR-519a stem-loop
Gene family MIPF0000020; mir-515
          u                           gugg  u 
5' cucaggc gugacccucuagagggaagcgcuuucu    uc g
   ||||||| |||||||||||||||||||||||||||    || a
3' gaguuug cauugggagauuuuccuucgugaaaga    ag a
          c                           --aa  a 
Get sequence
Deep sequencing
477 reads, 476 reads per million, 2 experiments
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr19: 59530409-59530493 [+]
Clustered miRNAs
< 10kb from mml-mir-519a
mml-mir-526bchr19: 59522999-59523081 [+]
mml-mir-519a-2chr19: 59523792-59523910 [+]
mml-mir-523achr19: 59527025-59527111 [+]
mml-mir-518fchr19: 59528995-59529081 [+]
mml-mir-519achr19: 59530409-59530493 [+]
mml-mir-518bchr19: 59532765-59532847 [+]
Database links

Mature sequence mml-miR-519a-5p

Accession MIMAT0026895

14 - 


 - 35

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mml-miR-519a-3p

Accession MIMAT0006384

53 - 


 - 77

Get sequence
Evidence experimental; Illumina [2]
Predicted targets


PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).