Stem-loop sequence mml-mir-519a

Accession MI0007795
Description Macaca mulatta miR-519a stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
       u                           gugg  u 
cucaggc gugacccucuagagggaagcgcuuucu    uc g
||||||| |||||||||||||||||||||||||||    || a
gaguuug cauugggagauuuuccuucgugaaaga    ag a
       c                           --aa  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 59801658-59801742 [+]
sense
ENSMMUT00000048743 ; mml-mir-519a-201; exon 1
Clustered miRNAs
< 10kb from mml-mir-519a
mml-mir-526b 19: 59794473-59794555 [+]
mml-mir-525 19: 59797667-59797752 [+]
mml-mir-523a 19: 59798513-59798599 [+]
mml-mir-518f 19: 59800483-59800569 [+]
mml-mir-519a 19: 59801658-59801742 [+]
mml-mir-518b 19: 59804018-59804100 [+]
mml-mir-518c 19: 59811368-59811468 [+]
Database links

Mature sequence mml-miR-519a-5p

Accession MIMAT0026895
Sequence

14 - 

ccucuagagggaagcgcuuucu

 - 35

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-519a-3p

Accession MIMAT0006384
Sequence

53 - 

aaagugcuuccuuuuagaggguuac

 - 77

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).