Stem-loop sequence mml-mir-519a

AccessionMI0007795 (change log)
DescriptionMacaca mulatta miR-519a stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
          u                           gugg  u 
5' cucaggc gugacccucuagagggaagcgcuuucu    uc g
   ||||||| |||||||||||||||||||||||||||    || a
3' gaguuug cauugggagauuuuccuucgugaaaga    ag a
          c                           --aa  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49046135-49046219 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-519a
mml-mir-526bchr19: 49038951-49039033 [+]
mml-mir-519a-2chr19: 49039745-49039863 [+]
mml-mir-525chr19: 49042145-49042230 [+]
mml-mir-523achr19: 49042991-49043077 [+]
mml-mir-518fchr19: 49044960-49045046 [+]
mml-mir-519achr19: 49046135-49046219 [+]
mml-mir-518bchr19: 49048495-49048577 [+]
mml-mir-518cchr19: 49056071-49056171 [+]
Database links

Mature sequence mml-miR-519a-5p

Accession MIMAT0026895
Sequence

14 - 

ccucuagagggaagcgcuuucu

 - 35

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-519a-3p

Accession MIMAT0006384
Sequence

53 - 

aaagugcuuccuuuuagaggguuac

 - 77

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).