Stem-loop sequence mml-mir-518f

AccessionMI0007794 (change log)
DescriptionMacaca mulatta miR-518f stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
          cu    c     ag        a    --a    gu 
5' ucucagg  guga ccucu  agggaagc cuuu   ucuu  g
   |||||||  |||| |||||  |||||||| ||||   ||||  u
3' agaguuu  cauu ggaga  ucccuucg gaaa   agga  g
          cu    a     cu        c    gaa    aa 
Get sequence
Deep sequencing
323 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49044960-49045046 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-518f
mml-mir-526bchr19: 49038951-49039033 [+]
mml-mir-519a-2chr19: 49039745-49039863 [+]
mml-mir-525chr19: 49042145-49042230 [+]
mml-mir-523achr19: 49042991-49043077 [+]
mml-mir-518fchr19: 49044960-49045046 [+]
mml-mir-519achr19: 49046135-49046219 [+]
mml-mir-518bchr19: 49048495-49048577 [+]
Database links

Mature sequence mml-miR-518f

Accession MIMAT0006383
Sequence

54 - 

aaagcgcuucccuucagagga

 - 74

Get sequence
Deep sequencing253 reads, 3 experiments
Evidence by similarity; MI0003154
Predicted targets

References

1