Stem-loop sequence mml-mir-518e

Accession MI0007793
Description Macaca mulatta miR-518e stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
        u     c            g  a     guga  u 
ucucaggc gugac cucuagagggaa cg uuucu    uc g
|||||||| ||||| |||||||||||| || |||||    || a
agaguuug cauug gagauuucccuu gu aaaga    ag a
        u     u            g  a     --aa  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 59860299-59860385 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-518e
mml-mir-519b 19: 59857036-59857116 [+]
mml-mir-521 19: 59858727-59858813 [+]
mml-mir-518e 19: 59860299-59860385 [+]
mml-mir-518a-2 19: 59862803-59862861 [+]
mml-mir-516a-1 19: 59864334-59864422 [+]
mml-mir-516a-2 19: 59869010-59869098 [+]
Database links

Mature sequence mml-miR-518e

Accession MIMAT0006382
Sequence

54 - 

aaaaugguucccuuuagagugu

 - 75

Get sequence
Evidence by similarity; MI0003177
Predicted targets

References

1