Stem-loop sequence mml-mir-518e

Accession MI0007793
Description Macaca mulatta miR-518e stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
           u     c            g  a     guga  u 
5' ucucaggc gugac cucuagagggaa cg uuucu    uc g
   |||||||| ||||| |||||||||||| || |||||    || a
3' agaguuug cauug gagauuucccuu gu aaaga    ag a
           u     u            g  a     --aa  a 
Get sequence
Deep sequencing
9 reads, 10.1 reads per million, 2 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr19: 59592493-59592579 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-518e
mml-mir-524 chr19: 59544889-59544973 [+]
mml-mir-519b chr19: 59589147-59589227 [+]
mml-mir-521 chr19: 59590923-59591009 [+]
mml-mir-518e chr19: 59592493-59592579 [+]
mml-mir-524 chr19: 59594913-59594997 [+]
mml-mir-516a-1 chr19: 59596267-59596355 [+]
mml-mir-516a-2 chr19: 59600958-59601046 [+]
Database links

Mature sequence mml-miR-518e

Accession MIMAT0006382
Sequence

54 - 

aaaaugguucccuuuagagugu

 - 75

Get sequence
Evidence by similarity; MI0003177
Predicted targets

References

1