Stem-loop sequence mml-mir-518c

AccessionMI0007791
DescriptionMacaca mulatta miR-518c stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
gcgagaaga     u                           uc    g  u 
         uuuca gcugugacucucuggagggaagcgcuu  uguu uc g
         ||||| |||||||||||||||||||||||||||  |||| || a
         agagu uggcauugagagauuucucuucgcgaa  acaa ag a
----cgaaa     u                           --    a  a 
Get sequence
Deep sequencing
68 reads, 48.4 reads per million, 3 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr19: 59543005-59543105 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-518c
mml-mir-518cchr19: 59543005-59543105 [+]
mml-mir-524chr19: 59544889-59544973 [+]
mml-mir-517achr19: 59546917-59547002 [+]
mml-mir-519dchr19: 59548064-59548154 [+]
mml-mir-524chr19: 59594913-59594997 [+]
Database links

Mature sequence mml-miR-518c-5p

Accession MIMAT0026894
Sequence

28 - 

uggagggaagcgcuuucuguu

 - 48

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mml-miR-518c-3p

Accession MIMAT0006380
Sequence

62 - 

caaagcgcuucucuuuagagagu

 - 84

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).