Stem-loop sequence mml-mir-518c

AccessionMI0007791 (change log)
DescriptionMacaca mulatta miR-518c stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   gcgagaaga     u                           uc    g  u 
5'          uuuca gcugugacucucuagagggaagcgcuu  uguu uc g
            ||||| |||||||||||||||||||||||||||  |||| || a
3'          agagu uggcauugagagauuucucuucgcgaa  acaa ag a
   ----cgaaa     u                           --    a  a 
Get sequence
Deep sequencing
600 reads, 0 reads per million, 6 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49056071-49056171 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-518c
mml-mir-519achr19: 49046135-49046219 [+]
mml-mir-518bchr19: 49048495-49048577 [+]
mml-mir-518cchr19: 49056071-49056171 [+]
mml-mir-524chr19: 49057948-49058032 [+]
mml-mir-517achr19: 49059963-49060048 [+]
mml-mir-519dchr19: 49061111-49061201 [+]
Database links

Mature sequence mml-miR-518c-5p

Accession MIMAT0026894
Sequence

28 - 

uagagggaagcgcuuucuguu

 - 48

Get sequence
Deep sequencing297 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-518c-3p

Accession MIMAT0006380
Sequence

62 - 

caaagcgcuucucuuuagagagu

 - 84

Get sequence
Deep sequencing174 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).