Stem-loop sequence mml-mir-518c

Accession MI0007791
Description Macaca mulatta miR-518c stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
gcgagaaga     u                           uc    g  u 
         uuuca gcugugacucucuggagggaagcgcuu  uguu uc g
         ||||| |||||||||||||||||||||||||||  |||| || a
         agagu uggcauugagagauuucucuucgcgaa  acaa ag a
----cgaaa     u                           --    a  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 59811368-59811468 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-518c
mml-mir-519a 19: 59801658-59801742 [+]
mml-mir-518b 19: 59804018-59804100 [+]
mml-mir-518c 19: 59811368-59811468 [+]
mml-mir-524 19: 59813163-59813247 [+]
mml-mir-517a 19: 59815178-59815263 [+]
mml-mir-519d 19: 59816326-59816416 [+]
Database links

Mature sequence mml-miR-518c-5p

Accession MIMAT0026894
Sequence

28 - 

uggagggaagcgcuuucuguu

 - 48

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-518c-3p

Accession MIMAT0006380
Sequence

62 - 

caaagcgcuucucuuuagagagu

 - 84

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).