Stem-loop sequence mml-mir-518b

Accession MI0007790
Description Macaca mulatta miR-518b stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
           c    c      a   a   uc    g  u 
ucaggcuguga ccuc agaggg agc cuu  uguu uc g
||||||||||| |||| |||||| ||| |||  |||| || a
aguuuggcauu ggag uuuccc ucg gaa  acga ag a
           a    a      c   c   --    a  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 59804018-59804100 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-518b
mml-mir-526b 19: 59794473-59794555 [+]
mml-mir-525 19: 59797667-59797752 [+]
mml-mir-523a 19: 59798513-59798599 [+]
mml-mir-518f 19: 59800483-59800569 [+]
mml-mir-519a 19: 59801658-59801742 [+]
mml-mir-518b 19: 59804018-59804100 [+]
mml-mir-518c 19: 59811368-59811468 [+]
mml-mir-524 19: 59813163-59813247 [+]
Database links

Mature sequence mml-miR-518b

Accession MIMAT0006379
Sequence

51 - 

caaagcgcuccccuuuagagg

 - 71

Get sequence
Evidence by similarity; MI0003156
Predicted targets

References

1