Stem-loop sequence mml-mir-518b

Accession MI0007790
Description Macaca mulatta miR-518b stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
              c    c      a   a   uc    g  u 
5' ucaggcuguga ccuc agaggg agc cuu  uguu uc g
   ||||||||||| |||| |||||| ||| |||  |||| || a
3' aguuuggcauu ggag uuuccc ucg gaa  acga ag a
              a    a      c   c   --    a  a 
Get sequence
Deep sequencing
98 reads, 83.6 reads per million, 2 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr19: 59532765-59532847 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-518b
mml-mir-526b chr19: 59522999-59523081 [+]
mml-mir-519a-2 chr19: 59523792-59523910 [+]
mml-mir-523a chr19: 59527025-59527111 [+]
mml-mir-518f chr19: 59528995-59529081 [+]
mml-mir-519a chr19: 59530409-59530493 [+]
mml-mir-518b chr19: 59532765-59532847 [+]
Database links

Mature sequence mml-miR-518b

Accession MIMAT0006379
Sequence

51 - 

caaagcgcuccccuuuagagg

 - 71

Get sequence
Evidence by similarity; MI0003156
Predicted targets

References

1