Stem-loop sequence mml-mir-518b

AccessionMI0007790 (change log)
DescriptionMacaca mulatta miR-518b stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
              c    c      a   a   uc    g  u 
5' ucaggcuguga ccuc agaggg agc cuu  uguu uc g
   ||||||||||| |||| |||||| ||| |||  |||| || a
3' aguuuggcauu ggag uuuccc ucg gaa  acga ag a
              a    a      c   c   --    a  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49048495-49048577 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-518b
mml-mir-526bchr19: 49038951-49039033 [+]
mml-mir-519a-2chr19: 49039745-49039863 [+]
mml-mir-525chr19: 49042145-49042230 [+]
mml-mir-523achr19: 49042991-49043077 [+]
mml-mir-518fchr19: 49044960-49045046 [+]
mml-mir-519achr19: 49046135-49046219 [+]
mml-mir-518bchr19: 49048495-49048577 [+]
mml-mir-518cchr19: 49056071-49056171 [+]
mml-mir-524chr19: 49057948-49058032 [+]
Database links

Mature sequence mml-miR-518b

Accession MIMAT0006379
Sequence

51 - 

caaagcgcuccccuuuagagg

 - 71

Get sequence
Evidence by similarity; MI0003156
Predicted targets

References

1