Stem-loop sequence mml-mir-518a-1

AccessionMI0007789 (change log)
DescriptionMacaca mulatta miR-518a-1 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
        u          ua           c      -g    c 
5' ucuca gcugugaccc  caaagggaagc cuuucu  uugu u
   ||||| ||||||||||  ||||||||||| ||||||  ||||  
3' agagu uggcauuggg  guuucucuucg gaaaga  agca a
        u          uc           u      aa    a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49066416-49066502 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-518a-1
mml-mir-524chr19: 49057948-49058032 [+]
mml-mir-517achr19: 49059963-49060048 [+]
mml-mir-519dchr19: 49061111-49061201 [+]
mml-mir-518a-1chr19: 49066416-49066502 [+]
mml-mir-520gchr19: 49068463-49068552 [+]
mml-mir-518d-1chr19: 49073236-49073345 [+]
mml-mir-518gchr19: 49075909-49075967 [+]
Database links

Mature sequence mml-miR-518a-5p

Accession MIMAT0006377
Sequence

16 - 

cuacaaagggaagcccuuucu

 - 36

Get sequence
Evidence not experimental

Mature sequence mml-miR-518a-3p

Accession MIMAT0006378
Sequence

54 - 

aaagugcuucucuuugcuggg

 - 74

Get sequence
Evidence not experimental

References

1