Stem-loop sequence mml-mir-518a-1

Accession MI0007789
Description Macaca mulatta miR-518a-1 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
     u          ua           c      -g    c 
ucuca gcugugaccc  caaagggaagc cuuucu  uugu u
||||| ||||||||||  ||||||||||| ||||||  ||||  
agagu uggcauuggg  guuucucuucg gaaaga  agca a
     u          uc           u      aa    a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 59821546-59821632 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-518a-1
mml-mir-524 19: 59813163-59813247 [+]
mml-mir-517a 19: 59815178-59815263 [+]
mml-mir-519d 19: 59816326-59816416 [+]
mml-mir-518a-1 19: 59821546-59821632 [+]
mml-mir-520g 19: 59823753-59823842 [+]
mml-mir-518d-1 19: 59827928-59828037 [+]
mml-mir-518g 19: 59830601-59830659 [+]
Database links

Mature sequence mml-miR-518a-5p

Accession MIMAT0006377
Sequence

16 - 

cuacaaagggaagcccuuucu

 - 36

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-518a-3p

Accession MIMAT0006378
Sequence

54 - 

aaagugcuucucuuugcuggg

 - 74

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1