Stem-loop sequence mml-mir-518a-1

AccessionMI0007789
DescriptionMacaca mulatta miR-518a-1 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
     u          ua           c      -g    c 
ucuca gcugugaccc  caaagggaagc cuuucu  uugu u
||||| ||||||||||  ||||||||||| ||||||  ||||  
agagu uggcauuggg  guuucucuucg gaaaga  agca a
     u          uc           u      aa    a 
Get sequence
Deep sequencing
32 reads, 23.9 reads per million, 2 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr19: 59553030-59553116 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-518a-1
mml-mir-524chr19: 59544889-59544973 [+]
mml-mir-517achr19: 59546917-59547002 [+]
mml-mir-519dchr19: 59548064-59548154 [+]
mml-mir-518a-1chr19: 59553030-59553116 [+]
mml-mir-524chr19: 59594913-59594997 [+]
Database links

Mature sequence mml-miR-518a-5p

Accession MIMAT0006377
Sequence

16 - 

cuacaaagggaagcccuuucu

 - 36

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence mml-miR-518a-3p

Accession MIMAT0006378
Sequence

54 - 

aaagugcuucucuuugcuggg

 - 74

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1