Stem-loop sequence mml-mir-517a

AccessionMI0007787 (change log)
Previous IDsmml-mir-517a;mml-mir-517
DescriptionMacaca mulatta miR-517a stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -    u  a     c       u   a    u    gugg  u 
5'  cuca gc gugac cucuaga gga gcac gucu    uc a
    |||| || ||||| ||||||| ||| |||| ||||    || a
3'  gagu ug cauug gagauuu ccu cgug uaga    ag a
   a    u  c     u       u   a    c    --aa  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49059963-49060048 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-517a
mml-mir-518cchr19: 49056071-49056171 [+]
mml-mir-524chr19: 49057948-49058032 [+]
mml-mir-517achr19: 49059963-49060048 [+]
mml-mir-519dchr19: 49061111-49061201 [+]
mml-mir-518a-1chr19: 49066416-49066502 [+]
mml-mir-520gchr19: 49068463-49068552 [+]
Database links

Mature sequence mml-miR-517a

Accession MIMAT0006375
Previous IDsmml-miR-517a;mml-miR-517
Sequence

53 - 

aucgugcauccuuuuagagugu

 - 74

Get sequence
Evidence by similarity; MI0003161
Predicted targets

References

1