Stem-loop sequence mml-mir-517a

Accession MI0007787
Previous IDs mml-mir-517a;mml-mir-517
Description Macaca mulatta miR-517a stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
-    u  a     c       u   a    u    gugg  u 
 cuca gc gugac cucuaga gga gcac gucu    uc a
 |||| || ||||| ||||||| ||| |||| ||||    || a
 gagu ug cauug gagauuu ccu cgug uaga    ag a
a    u  c     u       u   a    c    --aa  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 59815178-59815263 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-517a
mml-mir-518c 19: 59811368-59811468 [+]
mml-mir-524 19: 59813163-59813247 [+]
mml-mir-517a 19: 59815178-59815263 [+]
mml-mir-519d 19: 59816326-59816416 [+]
mml-mir-518a-1 19: 59821546-59821632 [+]
mml-mir-520g 19: 59823753-59823842 [+]
Database links

Mature sequence mml-miR-517a

Accession MIMAT0006375
Previous IDs mml-miR-517a;mml-miR-517
Sequence

53 - 

aucgugcauccuuuuagagugu

 - 74

Get sequence
Evidence by similarity; MI0003161
Predicted targets

References

1