Stem-loop sequence mml-mir-517a

Accession MI0007787
Previous IDs mml-mir-517a;mml-mir-517
Description Macaca mulatta miR-517a stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
   -    u  a     c       u   a    u    gugg  u 
5'  cuca gc gugac cucuaga gga gcac gucu    uc a
    |||| || ||||| ||||||| ||| |||| ||||    || a
3'  gagu ug cauug gagauuu ccu cgug uaga    ag a
   a    u  c     u       u   a    c    --aa  a 
Get sequence
Deep sequencing
76 reads, 41.3 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr19: 59546917-59547002 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-517a
mml-mir-518c chr19: 59543005-59543105 [+]
mml-mir-524 chr19: 59544889-59544973 [+]
mml-mir-517a chr19: 59546917-59547002 [+]
mml-mir-519d chr19: 59548064-59548154 [+]
mml-mir-518a-1 chr19: 59553030-59553116 [+]
mml-mir-524 chr19: 59594913-59594997 [+]
Database links

Mature sequence mml-miR-517a

Accession MIMAT0006375
Previous IDs mml-miR-517a;mml-miR-517
Sequence

53 - 

aucgugcauccuuuuagagugu

 - 74

Get sequence
Evidence by similarity; MI0003161
Predicted targets

References

1