Stem-loop sequence mml-mir-516a-2

Accession MI0007786
Description Macaca mulatta miR-516a-2 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
               gu    a    a            guug  u 
ucucaggcugugacc  cucg ggaa gaagcacuuucu    uc a
|||||||||||||||  |||| |||| ||||||||||||    ||  
agaguuuggcauugg  gagc ccuu cuuugugaagga    ag a
               --    -    c            --aa  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 59869010-59869098 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-516a-2
mml-mir-518e 19: 59860299-59860385 [+]
mml-mir-518a-2 19: 59862803-59862861 [+]
mml-mir-516a-1 19: 59864334-59864422 [+]
mml-mir-516a-2 19: 59869010-59869098 [+]
Database links

Mature sequence mml-miR-516a-5p

Accession MIMAT0006373
Sequence

16 - 

gucucgaggaaagaagcacuuu

 - 37

Get sequence
Evidence by similarity; MI0003180
Predicted targets

Mature sequence mml-miR-516a-3p

Accession MIMAT0006374
Sequence

60 - 

uguuuccuucccgagggu

 - 77

Get sequence
Evidence by similarity; MI0003180
Predicted targets

References

1