Stem-loop sequence mml-mir-516a-1

AccessionMI0007785 (change log)
DescriptionMacaca mulatta miR-516a-1 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
                  gu    a    a            guug  u 
5' ucucaggcugugacc  cucg ggaa gaagcacuuucu    uc a
   |||||||||||||||  |||| |||| ||||||||||||    ||  
3' agaguuuggcauugg  gagc ccuu cuuugugaagga    ag a
                  --    -    c            --aa  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49109628-49109716 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-516a-1
mml-mir-519bchr19: 49102330-49102410 [+]
mml-mir-521chr19: 49104021-49104107 [+]
mml-mir-518echr19: 49105593-49105679 [+]
mml-mir-518a-2chr19: 49108097-49108155 [+]
mml-mir-516a-1chr19: 49109628-49109716 [+]
mml-mir-516a-2chr19: 49114285-49114373 [+]
mml-mir-517bchr19: 49115787-49115898 [+]
Database links

Mature sequence mml-miR-516a-5p

Accession MIMAT0006373
Sequence

16 - 

gucucgaggaaagaagcacuuu

 - 37

Get sequence
Evidence by similarity; MI0003180
Predicted targets

Mature sequence mml-miR-516a-3p

Accession MIMAT0006374
Sequence

60 - 

uguuuccuucccgagggu

 - 77

Get sequence
Evidence by similarity; MI0003180
Predicted targets

References

1