Stem-loop sequence mml-mir-516a-1

AccessionMI0007785
DescriptionMacaca mulatta miR-516a-1 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
               gu    a    a            guug  u 
ucucaggcugugacc  cucg ggaa gaagcacuuucu    uc a
|||||||||||||||  |||| |||| ||||||||||||    ||  
agaguuuggcauugg  gagc ccuu cuuugugaagga    ag a
               --    -    c            --aa  a 
Get sequence
Deep sequencing
11 reads, 3.8 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr19: 59596267-59596355 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-516a-1
mml-mir-524chr19: 59544889-59544973 [+]
mml-mir-519bchr19: 59589147-59589227 [+]
mml-mir-521chr19: 59590923-59591009 [+]
mml-mir-518echr19: 59592493-59592579 [+]
mml-mir-524chr19: 59594913-59594997 [+]
mml-mir-516a-1chr19: 59596267-59596355 [+]
mml-mir-516a-2chr19: 59600958-59601046 [+]
Database links

Mature sequence mml-miR-516a-5p

Accession MIMAT0006373
Sequence

16 - 

gucucgaggaaagaagcacuuu

 - 37

Get sequence
Evidence by similarity; MI0003180
Predicted targets

Mature sequence mml-miR-516a-3p

Accession MIMAT0006374
Sequence

60 - 

uguuuccuucccgagggu

 - 77

Get sequence
Evidence by similarity; MI0003180
Predicted targets

References

1