Stem-loop sequence mml-mir-512

Accession MI0007782
Previous IDs mml-mir-512-1
Description Macaca mulatta miR-512 stem-loop
Gene family MIPF0000518; mir-512
Stem-loop
   u    c  ug   ca      cuc  g         uggug 
5'  cuca uc  ugg  cucagc   gg ggcacuuuc     u
    |||| ||  |||  ||||||   || |||||||||      
3'  gagu ag  acc  gagucg   cu ucgugaaag     c
   g    c  ua   ua      uua  g         uaaga 
Get sequence
Deep sequencing
139 reads, 48.9 reads per million, 5 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-512-5p

Accession MIMAT0006371
Sequence

14 - 

cacucagccucgggggcacuuuc

 - 36

Get sequence
Evidence by similarity; MI0003141
Predicted targets

Mature sequence mml-miR-512-3p

Accession MIMAT0006372
Sequence

51 - 

aagugcugucauugcugagauc

 - 72

Get sequence
Deep sequencing 9 reads, 2 experiments
Evidence by similarity; MI0003141
Predicted targets

References

1