Stem-loop sequence mml-mir-512

Accession MI0007782
Previous IDs mml-mir-512-1
Description Macaca mulatta miR-512 stem-loop
Gene family MIPF0000518; mir-512
Stem-loop
u    c  ug   ca      cuc  g         uggug 
 cuca uc  ugg  cucagc   gg ggcacuuuc     u
 |||| ||  |||  ||||||   || |||||||||      
 gagu ag  acc  gagucg   cu ucgugaaag     c
g    c  ua   ua      uua  g         uaaga 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
19: 59772747-59772830 [+]
sense
ENSMMUT00000038227 ; mml-mir-512-201; exon 1
Clustered miRNAs
< 10kb from mml-mir-512
mml-mir-512 19: 59772747-59772830 [+]
mml-mir-1323 19: 59774845-59774952 [+]
mml-mir-498 19: 59776909-59777032 [+]
Database links

Mature sequence mml-miR-512-5p

Accession MIMAT0006371
Sequence

14 - 

cacucagccucgggggcacuuuc

 - 36

Get sequence
Evidence by similarity; MI0003141
Predicted targets

Mature sequence mml-miR-512-3p

Accession MIMAT0006372
Sequence

51 - 

aagugcugucauugcugagauc

 - 72

Get sequence
Evidence by similarity; MI0003141
Predicted targets

References

1