Stem-loop sequence mml-mir-511

AccessionMI0007780 (change log)
Previous IDsmml-mir-511-1
DescriptionMacaca mulatta miR-511 stem-loop
Gene family MIPF0000130; mir-506
Literature search

1 open access papers mention mml-mir-511
(1 sentences)

Stem-loop
       a   a    cc            cu   g   g    ua 
5' caau gac ccca  uugucuuuugcu  gca uca uaaa  u
   |||| ||| ||||  ||||||||||||  ||| ||| ||||   
3' guua cug gggu  gacagaaaacga  ugu agu guuu  u
       c   g    aa            ug   a   -    uu 
Get sequence
Deep sequencing
1884 reads, 22.2 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr9: 17995109-17995195 [+]
sense
Database links

Mature sequence mml-miR-511-5p

Accession MIMAT0006370
Sequence

17 - 

ugucuuuugcucugcaguca

 - 36

Get sequence
Deep sequencing112 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-511-3p

Accession MIMAT0026893
Sequence

54 - 

aauguguagcaaaagacagaau

 - 75

Get sequence
Deep sequencing1767 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).