Stem-loop sequence mml-mir-505

AccessionMI0007779
DescriptionMacaca mulatta miR-505 stem-loop
Gene family MIPF0000217; mir-505
Stem-loop
     ac    u           g    a        ucug 
gaugc  ccag gggggagccag aagu uugauguu    c
|||||  |||| ||||||||||| |||| ||||||||    c
cuacg  gguc cuccuuugguc uuca aacugcga    a
     -a    u           g    c        uuug 
Get sequence
Deep sequencing
343 reads, 7.77 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chrX: 139191220-139191303 [-]
intergenic
Database links

Mature sequence mml-miR-505-5p

Accession MIMAT0026892
Sequence

14 - 

ggggagccaggaaguauugaugu

 - 36

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]

Mature sequence mml-miR-505-3p

Accession MIMAT0006369
Sequence

51 - 

cgucaacacuugcugguuuccu

 - 72

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).