Stem-loop sequence mml-mir-504

Accession MI0007778
Description Macaca mulatta miR-504 stem-loop
Gene family MIPF0000437; mir-504
Stem-loop
   -g    -            g     a    -a  u   u 
gcu  cugu ugggagacccug ucugc cucu  uc gua u
|||  |||| |||||||||||| ||||| ||||  || |||  
cgg  gaca acccuuugggac ggacg gagg  ag cau c
   ga    u            g     c    ga  u   u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 136789628-136789710 [-]
sense
ENSMMUT00000017501 ; FGF13-202; intron 3
ENSMMUT00000017503 ; FGF13-201; intron 3
Database links

Mature sequence mml-miR-504-5p

Accession MIMAT0006368
Sequence

13 - 

agacccuggucugcacucuauc

 - 34

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-504-3p

Accession MIMAT0026891
Sequence

50 - 

gggagcgcagggcaggguuuc

 - 70

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).