Stem-loop sequence mml-mir-503

AccessionMI0007777
DescriptionMacaca mulatta miR-503 stem-loop
Gene family MIPF0000183; mir-503
Stem-loop
      a              u  g   -----   g 
ugcccu gcagcgggaacagu cu cag     uga u
|||||| |||||||||||||| || |||     |||  
auggga cgucgccuuuguua ga guc     acu g
      c              u  g   ucaug   a 
Get sequence
Deep sequencing
751 reads, 55.3 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chrX: 133868518-133868588 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-503
mml-mir-503chrX: 133868518-133868588 [-]
mml-mir-542chrX: 133863537-133863633 [-]
mml-mir-450a-2chrX: 133862710-133862809 [-]
mml-mir-450a-1chrX: 133862543-133862633 [-]
Database links

Mature sequence mml-miR-503-5p

Accession MIMAT0006367
Sequence

6 - 

uagcagcgggaacaguucugcag

 - 28

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-503-3p

Accession MIMAT0026890
Sequence

46 - 

ggaguauuguuuccgcugccagg

 - 68

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).