Stem-loop sequence mml-mir-503

AccessionMI0007777 (change log)
DescriptionMacaca mulatta miR-503 stem-loop
Gene family MIPF0000183; mir-503
Stem-loop
         a              u  g   -----   g 
5' ugcccu gcagcgggaacagu cu cag     uga u
   |||||| |||||||||||||| || |||     |||  
3' auggga cgucgccuuuguua ga guc     acu g
         c              u  g   ucaug   a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 128518109-128518179 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-503
mml-mir-424chrX: 128518416-128518513 [-]
mml-mir-503chrX: 128518109-128518179 [-]
mml-mir-542chrX: 128513131-128513227 [-]
mml-mir-450a-2chrX: 128512304-128512403 [-]
mml-mir-450a-1chrX: 128512137-128512227 [-]
mml-mir-450bchrX: 128511981-128512058 [-]
Database links

Mature sequence mml-miR-503-5p

Accession MIMAT0006367
Sequence

6 - 

uagcagcgggaacaguucugcag

 - 28

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-503-3p

Accession MIMAT0026890
Sequence

46 - 

ggaguauuguuuccgcugccagg

 - 68

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).