Stem-loop sequence mml-mir-502

AccessionMI0007776
DescriptionMacaca mulatta miR-502 stem-loop
Gene family MIPF0000139; mir-500
Stem-loop
------        -         uau ug     uag   ugu 
      cccucucu aauccuugc   c  ggugc   ugc   c
      |||||||| |||||||||   |  |||||   |||   u
      gggagaga uuaggaacg   g  ccacg   acg   c
ucgagg        c         --- gu     -ua   uaa 
Get sequence
Deep sequencing
1544 reads, 73.8 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
JH290886.1: 46570-46649 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-502
mml-mir-500aJH290886.1: 38665-38748 [+]
mml-mir-362JH290886.1: 39196-39260 [+]
mml-mir-501JH290886.1: 39956-40039 [+]
mml-mir-500bJH290886.1: 42676-42736 [+]
mml-mir-660JH290886.1: 45211-45307 [+]
mml-mir-502JH290886.1: 46570-46649 [+]
Database links

Mature sequence mml-miR-502-5p

Accession MIMAT0006365
Sequence

10 - 

auccuugcuaucugggugcua

 - 30

Get sequence
Evidence by similarity; MI0003186
Predicted targets

Mature sequence mml-miR-502-3p

Accession MIMAT0006366
Sequence

46 - 

aaugcaccugggcaaggauuca

 - 67

Get sequence
Deep sequencing8 reads, 3 experiments
Evidence by similarity; MI0003186
Predicted targets

References

1