Stem-loop sequence mml-mir-502

AccessionMI0007776 (change log)
DescriptionMacaca mulatta miR-502 stem-loop
Gene family MIPF0000139; mir-500
Stem-loop
   ------        -         uau ug     uag   ugu 
5'       cccucucu aauccuugc   c  ggugc   ugc   c
         |||||||| |||||||||   |  |||||   |||   u
3'       gggagaga uuaggaacg   g  ccacg   acg   c
   ucgagg        c         --- gu     -ua   uaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 50021926-50022005 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-502
mml-mir-500achrX: 50013494-50013577 [+]
mml-mir-362chrX: 50014025-50014089 [+]
mml-mir-501chrX: 50014785-50014868 [+]
mml-mir-500bchrX: 50017286-50017346 [+]
mml-mir-660chrX: 50020567-50020663 [+]
mml-mir-502chrX: 50021926-50022005 [+]
Database links

Mature sequence mml-miR-502-5p

Accession MIMAT0006365
Sequence

10 - 

auccuugcuaucugggugcua

 - 30

Get sequence
Evidence by similarity; MI0003186
Predicted targets

Mature sequence mml-miR-502-3p

Accession MIMAT0006366
Sequence

46 - 

aaugcaccugggcaaggauuca

 - 67

Get sequence
Evidence by similarity; MI0003186
Predicted targets

References

1