Stem-loop sequence mml-mir-502

Accession MI0007776
Description Macaca mulatta miR-502 stem-loop
Gene family MIPF0000139; mir-500
Stem-loop
------        -         uau ug     uag   ugu 
      cccucucu aauccuugc   c  ggugc   ugc   c
      |||||||| |||||||||   |  |||||   |||   u
      gggagaga uuaggaacg   g  ccacg   acg   c
ucgagg        c         --- gu     -ua   uaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 47651105-47651184 [+]
sense
ENSMMUT00000032444 ; CLCN5-201; intron 3
Clustered miRNAs
< 10kb from mml-mir-502
mml-mir-500a X: 47643501-47643584 [+]
mml-mir-362 X: 47644032-47644096 [+]
mml-mir-501 X: 47644792-47644875 [+]
mml-mir-500b X: 47647191-47647251 [+]
mml-mir-660 X: 47649746-47649842 [+]
mml-mir-502 X: 47651105-47651184 [+]
Database links

Mature sequence mml-miR-502-5p

Accession MIMAT0006365
Sequence

10 - 

auccuugcuaucugggugcua

 - 30

Get sequence
Evidence by similarity; MI0003186
Predicted targets

Mature sequence mml-miR-502-3p

Accession MIMAT0006366
Sequence

46 - 

aaugcaccugggcaaggauuca

 - 67

Get sequence
Evidence by similarity; MI0003186
Predicted targets

References

1