|
miRBase |
|
Stem-loop sequence mml-mir-501 |
|||||
| Accession | MI0007775 | ||||
| Description | Macaca mulatta miR-501 stem-loop | ||||
| Gene family | MIPF0000139; mir-500 | ||||
| Stem-loop |
u -u uguc ag g uuu gcuc uccucuc aauccuu ccugggug a ugc c |||| ||||||| ||||||| |||||||| | ||| u cgag gggagag uuaggaa ggacccac u acg g u uc ---c -g g uaa |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links |
|
||||
Mature sequence mml-miR-501 |
|
| Accession | MIMAT0006364 |
| Sequence |
14 - aauccuuugucccugggugaga - 35 |
| Evidence | by similarity; MI0003185 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|