Stem-loop sequence mml-mir-501

AccessionMI0007775 (change log)
DescriptionMacaca mulatta miR-501 stem-loop
Gene family MIPF0000139; mir-500
Stem-loop
       u       -u       uguc        ag g   uuu 
5' gcuc uccucuc  aauccuu    ccugggug  a ugc   c
   |||| |||||||  |||||||    ||||||||  | |||   u
3' cgag gggagag  uuaggaa    ggacccac  u acg   g
       u       uc       ---c        -g g   uaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 50014785-50014868 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-501
mml-mir-532chrX: 50008220-50008297 [+]
mml-mir-188chrX: 50008578-50008663 [+]
mml-mir-500achrX: 50013494-50013577 [+]
mml-mir-362chrX: 50014025-50014089 [+]
mml-mir-501chrX: 50014785-50014868 [+]
mml-mir-500bchrX: 50017286-50017346 [+]
mml-mir-660chrX: 50020567-50020663 [+]
mml-mir-502chrX: 50021926-50022005 [+]
Database links

Mature sequence mml-miR-501-5p

Accession MIMAT0006364
Sequence

14 - 

aauccuuugucccugggugaga

 - 35

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-501-3p

Accession MIMAT0026889
Sequence

54 - 

gcacccaggcaaggauucu

 - 72

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).