Stem-loop sequence mml-mir-500a

Accession MI0007774
Description Macaca mulatta miR-500a stem-loop
Gene family MIPF0000139; mir-500
Stem-loop
    c c     -u         uac ug    agag   uau 
gcuc c cucuc  aauccuugc   c  ggug    ugc   c
|||| | |||||  |||||||||   |  ||||    |||   u
cgag g gagag  uuaggaacg   g  ccac    acg   g
    a c     uc         --- gu    -gua   uaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
X: 47643501-47643584 [+]
sense
ENSMMUT00000032444 ; CLCN5-201; intron 3
Clustered miRNAs
< 10kb from mml-mir-500a
mml-mir-532 X: 47638245-47638322 [+]
mml-mir-188 X: 47638603-47638688 [+]
mml-mir-500a X: 47643501-47643584 [+]
mml-mir-362 X: 47644032-47644096 [+]
mml-mir-501 X: 47644792-47644875 [+]
mml-mir-500b X: 47647191-47647251 [+]
mml-mir-660 X: 47649746-47649842 [+]
mml-mir-502 X: 47651105-47651184 [+]
Database links

Mature sequence mml-miR-500a-5p

Accession MIMAT0006363
Sequence

13 - 

uaauccuugcuaccugggugaga

 - 35

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-500a-3p

Accession MIMAT0026888
Sequence

52 - 

augcaccugggcaaggauucuga

 - 74

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).