Stem-loop sequence mml-mir-500a

AccessionMI0007774 (change log)
DescriptionMacaca mulatta miR-500a stem-loop
Gene family MIPF0000139; mir-500
Stem-loop
       c c     -u         uac ug    agag   uau 
5' gcuc c cucuc  aauccuugc   c  ggug    ugc   c
   |||| | |||||  |||||||||   |  ||||    |||   u
3' cgag g gagag  uuaggaacg   g  ccac    acg   g
       a c     uc         --- gu    -gua   uaa 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chrX: 50013494-50013577 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-500a
mml-mir-532chrX: 50008220-50008297 [+]
mml-mir-188chrX: 50008578-50008663 [+]
mml-mir-500achrX: 50013494-50013577 [+]
mml-mir-362chrX: 50014025-50014089 [+]
mml-mir-501chrX: 50014785-50014868 [+]
mml-mir-500bchrX: 50017286-50017346 [+]
mml-mir-660chrX: 50020567-50020663 [+]
mml-mir-502chrX: 50021926-50022005 [+]
Database links

Mature sequence mml-miR-500a-5p

Accession MIMAT0006363
Sequence

13 - 

uaauccuugcuaccugggugaga

 - 35

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-500a-3p

Accession MIMAT0026888
Sequence

52 - 

augcaccugggcaaggauucuga

 - 74

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).