Stem-loop sequence mml-mir-500a

AccessionMI0007774
DescriptionMacaca mulatta miR-500a stem-loop
Gene family MIPF0000139; mir-500
Stem-loop
    c c     -u         uac ug    agag   uau 
gcuc c cucuc  aauccuugc   c  ggug    ugc   c
|||| | |||||  |||||||||   |  ||||    |||   u
cgag g gagag  uuaggaacg   g  ccac    acg   g
    a c     uc         --- gu    -gua   uaa 
Get sequence
Deep sequencing
1940 reads, 91.8 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
JH290886.1: 38665-38748 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-500a
mml-mir-532JH290886.1: 33403-33480 [+]
mml-mir-188JH290886.1: 33761-33846 [+]
mml-mir-500aJH290886.1: 38665-38748 [+]
mml-mir-362JH290886.1: 39196-39260 [+]
mml-mir-501JH290886.1: 39956-40039 [+]
mml-mir-500bJH290886.1: 42676-42736 [+]
mml-mir-660JH290886.1: 45211-45307 [+]
mml-mir-502JH290886.1: 46570-46649 [+]
Database links

Mature sequence mml-miR-500a-5p

Accession MIMAT0006363
Sequence

13 - 

uaauccuugcuaccugggugaga

 - 35

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-500a-3p

Accession MIMAT0026888
Sequence

52 - 

augcaccugggcaaggauucuga

 - 74

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).