Stem-loop sequence mml-mir-499

Accession MI0007773
Description Macaca mulatta miR-499 stem-loop
Gene family MIPF0000173; mir-499
Stem-loop
            --- c    cuu       c   u  ua        a          acucc 
5' gcccugucc   c gugu   gggcggg agc gu  agacuugc gugauguuua     u
   |||||||||   | ||||   ||||||| ||| ||  |||||||| ||||||||||     c
3' ugggacggg   g cgca   ccugccc ucg cg  ucugaacg cacuacaagu     u
            ucc u    -uc       u   u  ug        a          gcacc 
Get sequence
Deep sequencing
102936 reads, 1.84e+03 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-499-5p

Accession MIMAT0006361
Sequence

32 - 

uuaagacuugcagugauguuu

 - 52

Get sequence
Deep sequencing 27 reads, 4 experiments
Evidence by similarity; MI0003183
Predicted targets

Mature sequence mml-miR-499-3p

Accession MIMAT0006362
Sequence

69 - 

aacaucacagcaagucugugcu

 - 90

Get sequence
Evidence by similarity; MI0003183
Predicted targets

References

1