Stem-loop sequence mml-mir-498

AccessionMI0007772
DescriptionMacaca mulatta miR-498 stem-loop
Gene family MIPF0000463; mir-498
Stem-loop
aaucc        -aag  aag            -         -a     c       ugug 
     uccuuggg    ug   cucaggcuguga uuucaagcc  ggggg guuuuuc    a
     ||||||||    ||   |||||||||||| |||||||||  ||||| |||||||    c
     aggaaucu    ac   gaguuugacacu gaaguucgg  ccucc cgaaaag    u
-uuga        acua  -ga            c         gg     a       uagg 
Get sequence
Deep sequencing
10 reads, 4.36 reads per million, 4 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr19: 59505667-59505790 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-498
mml-mir-1323chr19: 59503727-59503834 [+]
mml-mir-498chr19: 59505667-59505790 [+]
mml-mir-519cchr19: 59513903-59513989 [+]
Database links

Mature sequence mml-miR-498

Accession MIMAT0006360
Sequence

34 - 

uuucaagccagggggcguuuuuc

 - 56

Get sequence
Evidence by similarity; MI0003142
Predicted targets

References

1