Stem-loop sequence mml-mir-498

AccessionMI0007772 (change log)
DescriptionMacaca mulatta miR-498 stem-loop
Gene family MIPF0000463; mir-498
Stem-loop
   aaucc        -aag  aag            -         -a     c       ugug 
5'      uccuuggg    ug   cucaggcuguga uuucaagcc  ggggg guuuuuc    a
        ||||||||    ||   |||||||||||| |||||||||  ||||| |||||||    c
3'      aggaaucu    ac   gaguuugacacu gaaguucgg  ccucc cgaaaag    u
   -uuga        acua  -ga            c         gg     a       uagg 
Get sequence
Deep sequencing
36 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 49021679-49021802 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-498
mml-mir-512chr19: 49017521-49017604 [+]
mml-mir-1323chr19: 49019624-49019731 [+]
mml-mir-498chr19: 49021679-49021802 [+]
mml-mir-519echr19: 49028305-49028414 [+]
mml-mir-519cchr19: 49030112-49030198 [+]
Database links

Mature sequence mml-miR-498

Accession MIMAT0006360
Sequence

34 - 

uuucaagccagggggcguuuuuc

 - 56

Get sequence
Deep sequencing27 reads, 3 experiments
Evidence by similarity; MI0003142
Predicted targets

References

1