Stem-loop sequence mml-mir-497

Accession MI0007771
Description Macaca mulatta miR-497 stem-loop
Gene family MIPF0000231; mir-497
Stem-loop
     a cc    -   g         - -----    g    c         u  --   ac 
5' cc c  cggu ccu cucccgccc c     agca caca ugugguuug ac  ggc  u
   || |  |||| ||| ||||||||| |     |||| |||| ||||||||| ||  |||   
3' gg g  gcca gga ggggguggg g     uugu gugu acaccaaac ug  ccg  g
     a cc    c   -         a cgaga    g    c         c  ca   gu 
Get sequence
Deep sequencing
5063 reads, 105 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr16: 7306476-7306587 [-]
antisense
ENSMMUT00000018950 ; CD68-201; 3'UTR (exon 1)
Clustered miRNAs
< 10kb from mml-mir-497
mml-mir-497 chr16: 7306476-7306587 [-]
mml-mir-195 chr16: 7306179-7306265 [-]
Database links

Mature sequence mml-miR-497-5p

Accession MIMAT0006359
Sequence

24 - 

cagcagcacacugugguuugu

 - 44

Get sequence
Deep sequencing 131 reads, 7 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-497-3p

Accession MIMAT0026887
Sequence

64 - 

caaaccacacugugguguuagagcgag

 - 90

Get sequence
Evidence experimental; Illumina [2]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).