Stem-loop sequence mml-mir-497

Accession MI0007771
Description Macaca mulatta miR-497 stem-loop
Gene family MIPF0000231; mir-497
Stem-loop
  a cc    -   g         - -----    g    c         u  --   ac 
cc c  cggu ccu cucccgccc c     agca caca ugugguuug ac  ggc  u
|| |  |||| ||| ||||||||| |     |||| |||| ||||||||| ||  |||   
gg g  gcca gga ggggguggg g     uugu gugu acaccaaac ug  ccg  g
  a cc    c   -         a cgaga    g    c         c  ca   gu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
16: 6730823-6730934 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-497
mml-mir-497 16: 6730823-6730934 [-]
mml-mir-195 16: 6730526-6730612 [-]
Database links

Mature sequence mml-miR-497-5p

Accession MIMAT0006359
Sequence

24 - 

cagcagcacacugugguuugu

 - 44

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

Mature sequence mml-miR-497-3p

Accession MIMAT0026887
Sequence

64 - 

caaaccacacugugguguuagagcgag

 - 90

Get sequence
Evidence experimental; Solexa [23034410]

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).