Stem-loop sequence mml-mir-496

AccessionMI0007770 (change log)
DescriptionMacaca mulatta miR-496 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
         -----uca     u    u        u     gu         uua 
5' cccgag        gguac cgaa ggagguug ccaug  guguucauu   u
   ||||||        ||||| |||| |||||||| |||||  |||||||||    
3' ggguuc        ucaug gcuu ccucuaac gguac  uaugaguag   u
         uucuuaac     -    u        c     au         uau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163394601-163394702 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-496
mml-mir-487achr7: 163386465-163386544 [+]
mml-mir-382chr7: 163388320-163388395 [+]
mml-mir-134chr7: 163388701-163388773 [+]
mml-mir-668chr7: 163389270-163389335 [+]
mml-mir-485chr7: 163389434-163389506 [+]
mml-mir-323bchr7: 163390241-163390297 [+]
mml-mir-154chr7: 163393750-163393833 [+]
mml-mir-496chr7: 163394601-163394702 [+]
mml-mir-377chr7: 163395850-163395918 [+]
mml-mir-541chr7: 163398288-163398371 [+]
mml-mir-409chr7: 163399096-163399174 [+]
mml-mir-412chr7: 163399243-163399333 [+]
mml-mir-369chr7: 163399393-163399462 [+]
mml-mir-410chr7: 163399706-163399785 [+]
mml-mir-656chr7: 163400519-163400596 [+]
Database links

Mature sequence mml-miR-496

Accession MIMAT0006358
Sequence

56 - 

ugaguauuacauggccaaucuc

 - 77

Get sequence
Evidence by similarity; MI0003136
Predicted targets

References

1