Stem-loop sequence mml-mir-496

Accession MI0007770
Description Macaca mulatta miR-496 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
      -----uca     u    u        u     gu         uua 
cccgag        gguac cgaa ggagguug ccaug  guguucauu   u
||||||        ||||| |||| |||||||| |||||  |||||||||    
ggguuc        ucaug gcuu ccucuaac gguac  uaugaguag   u
      uucuuaac     -    u        c     au         uau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164344514-164344615 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-496
mml-mir-487a 7: 164336378-164336457 [+]
mml-mir-382 7: 164338233-164338308 [+]
mml-mir-134 7: 164338614-164338686 [+]
mml-mir-668 7: 164339183-164339248 [+]
mml-mir-485 7: 164339347-164339419 [+]
mml-mir-323b 7: 164340154-164340210 [+]
mml-mir-154 7: 164343663-164343746 [+]
mml-mir-496 7: 164344514-164344615 [+]
mml-mir-377 7: 164345705-164345773 [+]
mml-mir-541 7: 164348143-164348226 [+]
mml-mir-409 7: 164348951-164349029 [+]
mml-mir-412 7: 164349098-164349188 [+]
mml-mir-369 7: 164349248-164349317 [+]
mml-mir-410 7: 164349561-164349640 [+]
mml-mir-656 7: 164350374-164350451 [+]
Database links

Mature sequence mml-miR-496

Accession MIMAT0006358
Sequence

56 - 

ugaguauuacauggccaaucuc

 - 77

Get sequence
Evidence by similarity; MI0003136
Predicted targets

References

1