Stem-loop sequence mml-mir-496

AccessionMI0007770
DescriptionMacaca mulatta miR-496 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
      -----uca     u    u        u     gu         uua 
cccgag        gguac cgaa ggagguug ccaug  guguucauu   u
||||||        ||||| |||| |||||||| |||||  |||||||||    
ggguuc        ucaug gcuu ccucuaac gguac  uaugaguag   u
      uucuuaac     -    u        c     au         uau 
Get sequence
Deep sequencing
81 reads, 1.58 reads per million, 6 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164959019-164959120 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-496
mml-mir-487achr7: 164950883-164950962 [+]
mml-mir-382chr7: 164952738-164952813 [+]
mml-mir-134chr7: 164953119-164953191 [+]
mml-mir-668chr7: 164953688-164953753 [+]
mml-mir-485chr7: 164953852-164953924 [+]
mml-mir-323bchr7: 164954659-164954715 [+]
mml-mir-154chr7: 164958168-164958251 [+]
mml-mir-496chr7: 164959019-164959120 [+]
mml-mir-377chr7: 164960414-164960482 [+]
mml-mir-541chr7: 164962858-164962941 [+]
mml-mir-409chr7: 164963666-164963744 [+]
mml-mir-412chr7: 164963813-164963903 [+]
mml-mir-369chr7: 164963963-164964032 [+]
mml-mir-410chr7: 164964276-164964355 [+]
mml-mir-656chr7: 164965089-164965166 [+]
Database links

Mature sequence mml-miR-496

Accession MIMAT0006358
Sequence

56 - 

ugaguauuacauggccaaucuc

 - 77

Get sequence
Evidence by similarity; MI0003136
Predicted targets

References

1