Stem-loop sequence mml-mir-495

AccessionMI0007769
DescriptionMacaca mulatta miR-495 stem-loop
Gene family MIPF0000110; mir-329
Stem-loop
u      u          u  -       au     - uuu 
 gguacc gaaaagaagu gc ccauguu  uuucg c   a
 |||||| |||||||||| || |||||||  ||||| |   u
 cuaugg uuuuucuuca cg gguacaa  aaagc g   a
a      c          -  u       ac     a ugu 
Get sequence
Deep sequencing
1704 reads, 25.4 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164932634-164932715 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-495
mml-mir-411chr7: 164923091-164923172 [+]
mml-mir-299chr7: 164923557-164923619 [+]
mml-mir-380chr7: 164924780-164924840 [+]
mml-mir-323achr7: 164925496-164925581 [+]
mml-mir-758chr7: 164925789-164925876 [+]
mml-mir-329-2chr7: 164926555-164926634 [+]
mml-mir-329-2chr7: 164926872-164926951 [+]
mml-mir-494chr7: 164928535-164928615 [+]
mml-mir-543chr7: 164930881-164930960 [+]
mml-mir-495chr7: 164932634-164932715 [+]
mml-mir-376cchr7: 164938114-164938179 [+]
mml-mir-376a-2chr7: 164938492-164938571 [+]
mml-mir-654chr7: 164938642-164938722 [+]
mml-mir-376bchr7: 164938859-164938958 [+]
mml-mir-376a-1chr7: 164939205-164939272 [+]
mml-mir-1185-2chr7: 164941410-164941468 [+]
Database links

Mature sequence mml-miR-495-5p

Accession MIMAT0026886
Sequence

14 - 

gaaguugcccauguuauuuucg

 - 35

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [2]

Mature sequence mml-miR-495-3p

Accession MIMAT0006357
Sequence

50 - 

aaacaaacauggugcacuucuu

 - 71

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).