Stem-loop sequence mml-mir-495

Accession MI0007769
Description Macaca mulatta miR-495 stem-loop
Gene family MIPF0000110; mir-329
Stem-loop
u      u          u  -       au     - uuu 
 gguacc gaaaagaagu gc ccauguu  uuucg c   a
 |||||| |||||||||| || |||||||  ||||| |   u
 cuaugg uuuuucuuca cg gguacaa  aaagc g   a
a      c          -  u       ac     a ugu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164318758-164318839 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-495
mml-mir-411 7: 164309121-164309202 [+]
mml-mir-299 7: 164309587-164309649 [+]
mml-mir-380 7: 164310810-164310870 [+]
mml-mir-323a 7: 164311526-164311611 [+]
mml-mir-758 7: 164311819-164311906 [+]
mml-mir-329-1 7: 164312583-164312666 [+]
mml-mir-329-2 7: 164312902-164312981 [+]
mml-mir-494 7: 164314563-164314643 [+]
mml-mir-543 7: 164316909-164316988 [+]
mml-mir-495 7: 164318758-164318839 [+]
mml-mir-376c 7: 164324189-164324254 [+]
mml-mir-376a-2 7: 164324567-164324646 [+]
mml-mir-654 7: 164324717-164324797 [+]
mml-mir-376b 7: 164324934-164325033 [+]
mml-mir-376a-1 7: 164325280-164325347 [+]
mml-mir-1185-2 7: 164327486-164327544 [+]
mml-mir-1185-1 7: 164328686-164328795 [+]
Database links

Mature sequence mml-miR-495-5p

Accession MIMAT0026886
Sequence

14 - 

gaaguugcccauguuauuuucg

 - 35

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-495-3p

Accession MIMAT0006357
Sequence

50 - 

aaacaaacauggugcacuucuu

 - 71

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).