Stem-loop sequence mml-mir-495

AccessionMI0007769 (change log)
DescriptionMacaca mulatta miR-495 stem-loop
Gene family MIPF0000110; mir-329
Stem-loop
   u      u          u  -       au     - uuu 
5'  gguacc gaaaagaagu gc ccauguu  uuucg c   a
    |||||| |||||||||| || |||||||  ||||| |   u
3'  cuaugg uuuuucuuca cg gguacaa  aaagc g   a
   a      c          -  u       ac     a ugu 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163368266-163368347 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-495
mml-mir-411chr7: 163358629-163358710 [+]
mml-mir-299chr7: 163359095-163359157 [+]
mml-mir-380chr7: 163360318-163360378 [+]
mml-mir-323achr7: 163361034-163361119 [+]
mml-mir-758chr7: 163361327-163361414 [+]
mml-mir-329-1chr7: 163362091-163362174 [+]
mml-mir-329-2chr7: 163362410-163362489 [+]
mml-mir-494chr7: 163364071-163364151 [+]
mml-mir-543chr7: 163366417-163366496 [+]
mml-mir-495chr7: 163368266-163368347 [+]
mml-mir-376cchr7: 163373697-163373762 [+]
mml-mir-376a-2chr7: 163374075-163374154 [+]
mml-mir-654chr7: 163374225-163374305 [+]
mml-mir-376bchr7: 163374442-163374541 [+]
mml-mir-376a-1chr7: 163374788-163374855 [+]
mml-mir-1185-2chr7: 163376994-163377052 [+]
mml-mir-1185-1chr7: 163378194-163378303 [+]
Database links

Mature sequence mml-miR-495-5p

Accession MIMAT0026886
Sequence

14 - 

gaaguugcccauguuauuuucg

 - 35

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-495-3p

Accession MIMAT0006357
Sequence

50 - 

aaacaaacauggugcacuucuu

 - 71

Get sequence
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).