|
miRBase |
|
Stem-loop sequence mml-mir-494 |
|||||
| Accession | MI0007768 | ||||
| Description | Macaca mulatta miR-494 stem-loop | ||||
| Gene family | MIPF0000018; mir-154 | ||||
| Stem-loop |
c gu - c - uuu gauacu gaaggagagguu ccgugu ugu uuc uc a |||||| |||||||||||| |||||| ||| ||| || u cuauga uuucuucuccaa ggcaca aca aag ag u - ag u - u uau |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links |
|
||||
Mature sequence mml-miR-494 |
|
| Accession | MIMAT0006356 |
| Sequence |
48 - ugaaacauacacgggaaaccuc - 69 |
| Evidence | by similarity; MI0003134 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|