Stem-loop sequence mml-mir-494

Accession MI0007768
Description Macaca mulatta miR-494 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
         c            gu      -   c   -  uuu 
5' gauacu gaaggagagguu  ccgugu ugu uuc uc   a
   |||||| ||||||||||||  |||||| ||| ||| ||   u
3' cuauga uuucuucuccaa  ggcaca aca aag ag   u
         -            ag      u   -   u  uau 
Get sequence
Deep sequencing
112 reads, 3.25 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164928535-164928615 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-494
mml-mir-379 chr7: 164921832-164921898 [+]
mml-mir-411 chr7: 164923091-164923172 [+]
mml-mir-299 chr7: 164923557-164923619 [+]
mml-mir-380 chr7: 164924780-164924840 [+]
mml-mir-323a chr7: 164925496-164925581 [+]
mml-mir-758 chr7: 164925789-164925876 [+]
mml-mir-329-2 chr7: 164926555-164926634 [+]
mml-mir-329-2 chr7: 164926872-164926951 [+]
mml-mir-494 chr7: 164928535-164928615 [+]
mml-mir-543 chr7: 164930881-164930960 [+]
mml-mir-495 chr7: 164932634-164932715 [+]
mml-mir-376c chr7: 164938114-164938179 [+]
mml-mir-376a-2 chr7: 164938492-164938571 [+]
Database links

Mature sequence mml-miR-494-5p

Accession MIMAT0026885
Sequence

15 - 

agguuguccguguugucuucucu

 - 37

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mml-miR-494-3p

Accession MIMAT0006356
Sequence

48 - 

ugaaacauacacgggaaaccuc

 - 69

Get sequence
Deep sequencing 11 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).