Stem-loop sequence mml-mir-493

AccessionMI0007767 (change log)
DescriptionMacaca mulatta miR-493 stem-loop
Gene family MIPF0000230; mir-493
Stem-loop
        cuc        u                    cauuc  u 
5' cuggc   cagggcuu guacaugguaggcuuucauu     gu u
   |||||   |||||||| ||||||||||||||||||||     ||  
3' gaccg   gucccgga cgugugucaucuggaagugg     ca g
        --u        c                    -cuua  c 
Get sequence
Deep sequencing
3336 reads, 0 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163202837-163202925 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-493
mml-mir-493chr7: 163202837-163202925 [+]
mml-mir-337chr7: 163207975-163208067 [+]
mml-mir-665chr7: 163208516-163208587 [+]
Database links

Mature sequence mml-miR-493-5p

Accession MIMAT0026884
Sequence

16 - 

uuguacaugguaggcuuucauu

 - 37

Get sequence
Deep sequencing1826 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-493-3p

Accession MIMAT0006355
Sequence

57 - 

ugaaggucuacugugugccagg

 - 78

Get sequence
Deep sequencing1508 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).