Stem-loop sequence mml-mir-493

Accession MI0007767
Description Macaca mulatta miR-493 stem-loop
Gene family MIPF0000230; mir-493
Stem-loop
     cuc        u                    cauuc  u 
cuggc   cagggcuu guacaugguaggcuuucauu     gu u
|||||   |||||||| ||||||||||||||||||||     ||  
gaccg   gucccgga cgugugucaucuggaagugg     ca g
     --u        c                    -cuua  c 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164153015-164153103 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-493
mml-mir-493 7: 164153015-164153103 [+]
mml-mir-337 7: 164158315-164158407 [+]
mml-mir-665 7: 164158856-164158927 [+]
Database links

Mature sequence mml-miR-493-5p

Accession MIMAT0026884
Sequence

16 - 

uuguacaugguaggcuuucauu

 - 37

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-493-3p

Accession MIMAT0006355
Sequence

57 - 

ugaaggucuacugugugccagg

 - 78

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).