Stem-loop sequence mml-mir-493

DescriptionMacaca mulatta miR-493 stem-loop
Gene family MIPF0000230; mir-493
     cuc        u                    cauuc  u 
cuggc   cagggcuu guacaugguaggcuuucauu     gu u
|||||   |||||||| ||||||||||||||||||||     ||  
gaccg   gucccgga cgugugucaucuggaagugg     ca g
     --u        c                    -cuua  c 
Get sequence
Deep sequencing
658 reads, 13.9 reads per million, 8 experiments
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164766619-164766707 [+]
Clustered miRNAs
< 10kb from mml-mir-493
mml-mir-493chr7: 164766619-164766707 [+]
mml-mir-337chr7: 164771909-164772001 [+]
mml-mir-665chr7: 164772450-164772521 [+]
Database links

Mature sequence mml-miR-493-5p

Accession MIMAT0026884

16 - 


 - 37

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [2]

Mature sequence mml-miR-493-3p

Accession MIMAT0006355

57 - 


 - 78

Get sequence
Evidence experimental; Illumina [2]
Predicted targets


PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).