|
miRBase |
|
Stem-loop sequence mml-mir-493 |
||||||||
| Accession | MI0007767 | |||||||
| Description | Macaca mulatta miR-493 stem-loop | |||||||
| Gene family | MIPF0000230; mir-493 | |||||||
| Stem-loop |
cuc u cauuc u cuggc cagggcuu guacaugguaggcuuucauu gu u ||||| |||||||| |||||||||||||||||||| || gaccg gucccgga cgugugucaucuggaagugg ca g --u c -cuua c |
|||||||
| Genome context |
|
|||||||
| Clustered miRNAs |
|
|||||||
| Database links |
|
|||||||
Mature sequence mml-miR-493 |
|
| Accession | MIMAT0006355 |
| Sequence |
57 - ugaaggucuacugugugccagg - 78 |
| Evidence | by similarity; MI0003132 |
| Predicted targets |
|
References |
|
| 1 |
PMID:18186931
"Identification of novel homologous microRNA genes in the rhesus macaque genome"
BMC Genomics. 9:8(2008).
|