Stem-loop sequence mml-mir-492

Accession MI0007766
Description Macaca mulatta miR-492 stem-loop
Gene family MIPF0000499; mir-492
Stem-loop
   --a  a      cuacu   a accuucgag  c           gau      u ccg  a 
5'    cu cagcca     aca g         ga cugcgggacaa   ucuugg g   uc a
      || ||||||     ||| |         || |||||||||||   |||||| |   || u
3'    ga gucggu     ugu c         cu gacguccuguu   aggacc c   ag g
   gua  c      ----c   c --guaacaa  a           ---      u --a  a 
Get sequence
Deep sequencing
108 reads, 2.29 reads per million, 7 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence mml-miR-492

Accession MIMAT0006354
Sequence

28 - 

aggaccugcgggacaagauucuu

 - 50

Get sequence
Evidence by similarity; MI0003131
Predicted targets

References

1