Stem-loop sequence mml-mir-492

AccessionMI0007766 (change log)
DescriptionMacaca mulatta miR-492 stem-loop
Gene family MIPF0000499; mir-492
Stem-loop
   acuacagccacuacuacaagaccuucgaggac           gau      u ccg  a 
5'                                 cugcgggacaa   ucuugg g   uc a
                                   |||||||||||   |||||| |   || u
3'                                 gacguccuguu   aggacc c   ag g
   ----guagacgucggucuguccguaacaacua           ---      u --a  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr5: 108774350-108774463 [-]
intergenic
Database links

Mature sequence mml-miR-492

Accession MIMAT0006354
Sequence

28 - 

aggaccugcgggacaagauucuu

 - 50

Get sequence
Evidence by similarity; MI0003131
Predicted targets

References

1