Stem-loop sequence mml-mir-492

Accession MI0007766
Description Macaca mulatta miR-492 stem-loop
Gene family MIPF0000499; mir-492
Stem-loop
--a  a      cuacu   a accuucgag  c           gau      u ccg  a 
   cu cagcca     aca g         ga cugcgggacaa   ucuugg g   uc a
   || ||||||     ||| |         || |||||||||||   |||||| |   || u
   ga gucggu     ugu c         cu gacguccuguu   aggacc c   ag g
gua  c      ----c   c --guaacaa  a           ---      u --a  a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
5: 102780172-102780285 [-]
sense
ENSMMUT00000032318 ; mml-mir-492-201; exon 1
Database links

Mature sequence mml-miR-492

Accession MIMAT0006354
Sequence

28 - 

aggaccugcgggacaagauucuu

 - 50

Get sequence
Evidence by similarity; MI0003131
Predicted targets

References

1