Stem-loop sequence mml-mir-491

Accession MI0007765
Description Macaca mulatta miR-491 stem-loop
Gene family MIPF0000319; mir-491
Stem-loop
    ug       ug     u      cc   c          a 
5' u  acuuagc  gguag ggggaa  cuu caugaggagu g
   |  |||||||  ||||| ||||||  ||| |||||||||| a
3' g  ugggucg  ccauc ucccuu  gaa guauuccuca a
    gu       gu     u      -a   c          c 
Get sequence
Deep sequencing
1587 reads, 21.7 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr15: 57109667-57109750 [-]
intergenic
Database links

Mature sequence mml-miR-491-5p

Accession MIMAT0006352
Sequence

16 - 

aguggggaacccuuccaugagg

 - 37

Get sequence
Deep sequencing 26 reads, 5 experiments
Evidence by similarity; MI0003126
Predicted targets

Mature sequence mml-miR-491-3p

Accession MIMAT0006353
Sequence

50 - 

cuuaugcaagauucccuucuac

 - 71

Get sequence
Evidence by similarity; MI0003126
Predicted targets

References

1