Stem-loop sequence mml-mir-490

Accession MI0007764
Description Macaca mulatta miR-490 stem-loop
Gene family MIPF0000229; mir-490
Stem-loop
u     -cc      g    -   aguucauu        c      --         g   caa   u 
 ggagg   uugcug uuug gaa        guucgaca caugga  ucuccaggu ggu   guu a
 |||||   |||||| |||| |||        |||||||| ||||||  ||||||||| |||   |||  
 ccuuc   ggcgac gaac cuu        cgaguugu guaccu  ggaggucca cca   uag g
a     aca      -    a   ------gu        c      ca         a   -cg   a 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
3: 174406300-174406427 [+]
intergenic
Database links

Mature sequence mml-miR-490-5p

Accession MIMAT0006350
Sequence

39 - 

ccauggaucuccaggugggu

 - 58

Get sequence
Evidence by similarity; MI0003125
Predicted targets

Mature sequence mml-miR-490-3p

Accession MIMAT0006351
Sequence

76 - 

caaccuggaggacuccaugcug

 - 97

Get sequence
Evidence by similarity; MI0003125
Predicted targets

References

1