Stem-loop sequence mml-mir-489

Accession MI0007763
Description Macaca mulatta miR-489 stem-loop
Gene family MIPF0000111; mir-489
Stem-loop
       c     g            gc c    ua     a 
guggcag uuggu gucguaugugug  g cauu  cuuga c
||||||| ||||| ||||||||||||  | ||||  |||||  
cauuguc aaucg cggcauauacac  c guga  ggauu c
       a     a            ua a    --     u 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
3: 123746812-123746895 [+]
sense
ENSMMUT00000042060 ; CALCR-202; intron 2
ENSMMUT00000020091 ; CALCR-201; intron 3
Clustered miRNAs
< 10kb from mml-mir-489
mml-mir-489 3: 123746812-123746895 [+]
mml-mir-653 3: 123747909-123748004 [+]
Database links

Mature sequence mml-miR-489-5p

Accession MIMAT0026883
Sequence

14 - 

ggucguauguguggcgccauuu

 - 35

Get sequence
Evidence experimental; Solexa [23034410]

Mature sequence mml-miR-489-3p

Accession MIMAT0006349
Sequence

52 - 

gugacaucacauauacggcagc

 - 73

Get sequence
Evidence experimental; Solexa [23034410]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).