Stem-loop sequence mml-mir-489

Accession MI0007763
Description Macaca mulatta miR-489 stem-loop
Gene family MIPF0000111; mir-489
Stem-loop
          c     g            gc c    ua     a 
5' guggcag uuggu gucguaugugug  g cauu  cuuga c
   ||||||| ||||| ||||||||||||  | ||||  |||||  
3' cauuguc aaucg cggcauauacac  c guga  ggauu c
          a     a            ua a    --     u 
Get sequence
Deep sequencing
427 reads, 13.9 reads per million, 5 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr3: 124365418-124365501 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-489
mml-mir-489 chr3: 124365418-124365501 [+]
mml-mir-653 chr3: 124366535-124366630 [+]
Database links

Mature sequence mml-miR-489-5p

Accession MIMAT0026883
Sequence

14 - 

ggucguauguguggcgccauuu

 - 35

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mml-miR-489-3p

Accession MIMAT0006349
Sequence

52 - 

gugacaucacauauacggcagc

 - 73

Get sequence
Deep sequencing 1 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).