Stem-loop sequence mml-mir-488

AccessionMI0007762
DescriptionMacaca mulatta miR-488 stem-loop
Gene family MIPF0000318; mir-488
Stem-loop
    a      cu  c   u      a  c        g u 
gaga ucaucu  cc aga aauggc cu ucaaacaa u u
|||| ||||||  || ||| |||||| || |||||||| | c
cucu aguaga  gg ucu uuaucg ga aguuuguu a c
    c      cu  u   -      -  a        g a 
Get sequence
Deep sequencing
4082 reads, 56 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr1: 207349000-207349082 [-]
intergenic
Database links

Mature sequence mml-miR-488-5p

Accession MIMAT0026882
Sequence

14 - 

cccagauaauggcacucucaaac

 - 36

Get sequence
Evidence experimental; Illumina [2]

Mature sequence mml-miR-488-3p

Accession MIMAT0006348
Sequence

52 - 

uugaaaggcuauuucuugguc

 - 72

Get sequence
Deep sequencing55 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).