Stem-loop sequence mml-mir-487b

Accession MI0007761
Description Macaca mulatta miR-487b stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
   u       ug        uuau      c u     uuuug 
5'  ugguacu  gagagugg    cccugu c guucg     c
    |||||||  ||||||||    |||||| | |||||      
3'  acuauga  uuuucacc    gggaca g uaagc     u
   a       cu        uacu      u c     ugugc 
Get sequence
Deep sequencing
2620 reads, 37.3 reads per million, 8 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164944875-164944958 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-487b
mml-mir-376c chr7: 164938114-164938179 [+]
mml-mir-376a-2 chr7: 164938492-164938571 [+]
mml-mir-654 chr7: 164938642-164938722 [+]
mml-mir-376b chr7: 164938859-164938958 [+]
mml-mir-376a-1 chr7: 164939205-164939272 [+]
mml-mir-1185-2 chr7: 164941410-164941468 [+]
mml-mir-1185-1 chr7: 164942609-164942718 [+]
mml-mir-381 chr7: 164944340-164944414 [+]
mml-mir-487b chr7: 164944875-164944958 [+]
mml-mir-539 chr7: 164945731-164945808 [+]
mml-mir-889 chr7: 164946308-164946386 [+]
mml-mir-544 chr7: 164947069-164947159 [+]
mml-mir-487a chr7: 164950883-164950962 [+]
mml-mir-382 chr7: 164952738-164952813 [+]
mml-mir-134 chr7: 164953119-164953191 [+]
mml-mir-668 chr7: 164953688-164953753 [+]
mml-mir-485 chr7: 164953852-164953924 [+]
mml-mir-323b chr7: 164954659-164954715 [+]
Database links

Mature sequence mml-miR-487b-5p

Accession MIMAT0026881
Sequence

15 - 

gugguuaucccuguccuguucg

 - 36

Get sequence
Deep sequencing 2 reads, 1 experiments
Evidence experimental; Illumina [2]

Mature sequence mml-miR-487b-3p

Accession MIMAT0006347
Sequence

51 - 

aaucguacagggucauccacuu

 - 72

Get sequence
Deep sequencing 37 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).