Stem-loop sequence mml-mir-487a

AccessionMI0007760 (change log)
DescriptionMacaca mulatta miR-487a stem-loop
Gene family MIPF0000018; mir-154
Literature search

1 open access papers mention mml-mir-487a
(4 sentences)

Stem-loop
         ug    g   uca      c    -    - uuu 
5' gguacu  gaga ugg   ucccug ugug uucg c   g
   ||||||  |||| |||   |||||| |||| |||| |   u
3' cuauga  uuuu acc   agggac auac aagc g   u
         cu    g   uac      -    u    a uau 
Get sequence
Deep sequencing
4 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr7: 163386465-163386544 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-487a
mml-mir-1185-2chr7: 163376994-163377052 [+]
mml-mir-1185-1chr7: 163378194-163378303 [+]
mml-mir-381chr7: 163379925-163379999 [+]
mml-mir-487bchr7: 163380460-163380543 [+]
mml-mir-539chr7: 163381316-163381393 [+]
mml-mir-889chr7: 163381893-163381971 [+]
mml-mir-544chr7: 163382652-163382742 [+]
mml-mir-487achr7: 163386465-163386544 [+]
mml-mir-382chr7: 163388320-163388395 [+]
mml-mir-134chr7: 163388701-163388773 [+]
mml-mir-668chr7: 163389270-163389335 [+]
mml-mir-485chr7: 163389434-163389506 [+]
mml-mir-323bchr7: 163390241-163390297 [+]
mml-mir-154chr7: 163393750-163393833 [+]
mml-mir-496chr7: 163394601-163394702 [+]
mml-mir-377chr7: 163395850-163395918 [+]
Database links

Mature sequence mml-miR-487a

Accession MIMAT0006346
Sequence

49 - 

aaucauacagggacauccaguu

 - 70

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence by similarity; MI0002471
Predicted targets

References

1