Stem-loop sequence mml-mir-487a

Accession MI0007760
Description Macaca mulatta miR-487a stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
      ug    g   uca      c    -    - uuu 
gguacu  gaga ugg   ucccug ugug uucg c   g
||||||  |||| |||   |||||| |||| |||| |   u
cuauga  uuuu acc   agggac auac aagc g   u
      cu    g   uac      -    u    a uau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (MMUL1.0) Overlapping transcripts
7: 164336378-164336457 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-487a
mml-mir-1185-2 7: 164327486-164327544 [+]
mml-mir-1185-1 7: 164328686-164328795 [+]
mml-mir-381 7: 164330417-164330491 [+]
mml-mir-487b 7: 164330952-164331035 [+]
mml-mir-539 7: 164331808-164331885 [+]
mml-mir-889 7: 164332385-164332463 [+]
mml-mir-544 7: 164333144-164333234 [+]
mml-mir-487a 7: 164336378-164336457 [+]
mml-mir-382 7: 164338233-164338308 [+]
mml-mir-134 7: 164338614-164338686 [+]
mml-mir-668 7: 164339183-164339248 [+]
mml-mir-485 7: 164339347-164339419 [+]
mml-mir-323b 7: 164340154-164340210 [+]
mml-mir-154 7: 164343663-164343746 [+]
mml-mir-496 7: 164344514-164344615 [+]
mml-mir-377 7: 164345705-164345773 [+]
Database links

Mature sequence mml-miR-487a

Accession MIMAT0006346
Sequence

49 - 

aaucauacagggacauccaguu

 - 70

Get sequence
Evidence by similarity; MI0002471
Predicted targets

References

1