Stem-loop sequence mml-mir-487a

AccessionMI0007760
DescriptionMacaca mulatta miR-487a stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
      ug    g   uca      c    -    - uuu 
gguacu  gaga ugg   ucccug ugug uucg c   g
||||||  |||| |||   |||||| |||| |||| |   u
cuauga  uuuu acc   agggac auac aagc g   u
      cu    g   uac      -    u    a uau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CR_1.0) Overlapping transcripts
chr7: 164950883-164950962 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-487a
mml-mir-1185-2chr7: 164941410-164941468 [+]
mml-mir-1185-1chr7: 164942609-164942718 [+]
mml-mir-381chr7: 164944340-164944414 [+]
mml-mir-487bchr7: 164944875-164944958 [+]
mml-mir-539chr7: 164945731-164945808 [+]
mml-mir-889chr7: 164946308-164946386 [+]
mml-mir-544chr7: 164947069-164947159 [+]
mml-mir-487achr7: 164950883-164950962 [+]
mml-mir-382chr7: 164952738-164952813 [+]
mml-mir-134chr7: 164953119-164953191 [+]
mml-mir-668chr7: 164953688-164953753 [+]
mml-mir-485chr7: 164953852-164953924 [+]
mml-mir-323bchr7: 164954659-164954715 [+]
mml-mir-154chr7: 164958168-164958251 [+]
mml-mir-496chr7: 164959019-164959120 [+]
mml-mir-377chr7: 164960414-164960482 [+]
Database links

Mature sequence mml-miR-487a

Accession MIMAT0006346
Sequence

49 - 

aaucauacagggacauccaguu

 - 70

Get sequence
Evidence by similarity; MI0002471
Predicted targets

References

1